AC CAG CCC AAG ATT ____________ Transcription: Translation:

Q: The potato arrived in Europe via the “Columbian Exchange.” Explain.

A: Potatoes are tubers and are one of the staple food in many countries. Different types of tubers are…

Q: 1. Explain the role of Statistics in biological science.

A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.

Q: Part A: A wild-type fruit fly with a smooth body, straight wings, red eyes and paired antennae (br+,…

A: Answer given in step 2. Please find the attached immage. Thank you.

Q: Von Gierkes disease is the deficiency of Glucose -6- phosphate O True O False is the precursor for…

A:

Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…

A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…

Q: What are the unifying characteristics of Gnathifera? Are these characteristics present in all…

A: Ahlrichs established the taxon Gnathifera based on morphological data. The Gnathostomulida and…

Q: What are 4 beneficial (mutualistic) and 4 harmful (antagonistic) interaction between two or more…

A: Beneficial mutualistc interaction improve agricultural production or food production... 1. The…

Q: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…

A: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…

Q: Can you explain the answer and how to find it

A: Both parents have blood type LMLN Genotype  Total sex children- Probability of three children have…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A:

Q: It  has  been  established  that  V.  parahaemolyticus  cross-reacts  with  many  marine  bacteria…

A: Serological tests signify those tests, that detect the antibodies against a microorganism. It…

Q: III- PROCEDURE: A. Show the crossing using punnett square for the following genetics problem set. 1.…

A: Huntington's disease is a very rare, autosomal dominant, inherited disease that causes the…

Q: explain the structure of skeletal muscle, linking the structure to their function as you do this.

A: A skeletal muscle is made up of hundreds or thousands of muscle fibers bundled together and encased…

Q: Recommendations for a healthy diet suggest which of the following energy distributions? A.…

A: Introduction Carbohydrates, lipids, and proteins are macronutrients that must be consumed in large…

Q: List and briefly define the 5 major types of cell attachments in animal cells.

A: Cell attachment is the first step in a process of compartment interactions that are essential for…

Q: How might the following findings be understood in terms of the adaptive value of female mate…

A: This is a type of behavioural sexual selection in which the behaviour or the characteristics shown…

Q: In owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: How do you identify Enterobacter aerogenes for the Urea test?

A: Enterobacter aerogenes are gram negative;motile;rod shaped bacteria which are responsible for…

Q: giving examples to illustrate your answer define both selective media and enrichment media as might…

A: Every microbiologist must eventually grow bacteria in the lab for research purposes. Bacterial…

Q: 1. Both parents have one dominant allele and one recessive allele. This means that they are…

A: Huntington's disease is a rare genetic condition that causes nerve cells in the brain to decompose…

Q: PRIMAL PICTURES 1. Name the nervous system receptor labeled A 2. Name the specific structure labeled…

A: The image provided above is an image from the anatomy of the skin. The anatomy of skin shows that…

Q: ewith a long tailed mouse. Multiple cresses of this short-tailed mouse to long-taled mice produces…

A: Genotype can be refer to a gene or set of genes that leads to a single trait or disease.

Q: THE PURPOSE OF LOCAL EXHAUST VENTILATION IS TO 1. preventing propagation of pollutants throughout…

A:

Q: To relate: "The evolution of natural selection and the evolution of features that reduces the…

A: Natural selection is defined as the physical and reproductive fitness of a species in changing…

Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…

A:

Q: Gamma globulins is synthesized in the liver True false plasma lipid is synthesis in the Kidney liver…

A: Please follow steps 2, 3 & 4 for detailed explanation.

Q: INDICATOR FOR EVALUATION OF EFFICIENCY OF WORK OF VENTILATION OF PREMISES OF RESIDENTIAL AND PUBLIC…

A: Answer is.. the content of harmful substances in the air.

Q: Which of the following are characteristics of minerals? Select all answers that apply. Inorganic Not…

A: Introduction Minerals are necessary for your frame's well-being. Minerals are used by your body…

Q: To explain: How would an uncoupler Dinitrophenol of oxidative phosphorylation promote weight loss.

A: The organic chemical compound 2,4-dinitrophenol (DNP) It is a biochemically active chemical that…

Q: Reproduction that involves two parents is called. Asexual reproduction Behaviour Genetics Sexual…

A: Biology is the study of life or living matter in all of its forms and manifestations, with a focus…

Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…

A: A calorie is a unit of energy.  It refers to the energy people get from food and drink they consume.

Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…

A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1  p is the frequency of the "A" allele…

Q: Use a cost–benefit approach to explain why females whose eggs are destroyed still remain with the…

A: Social animals often form long-lasting relationships with fellow group members, usually with…

Q: cells in the thyroid gland secrete calcitonin which -------calcium concentration decrease increase O…

A: Hormones are chemicals that essentially function as messengers of the body. These chemicals are…

Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…

A: These are term related to animal diversity.

Q: 1. Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…

A: Derived traits and Primitive traits Every individual bears some kind of characteristics specifically…

Q: 9. Coronary arteries route oxygen rich blood into the tissues of the heart. They branch off of the:…

A: As per our honor code, we are allowed to answer only one question at a moment. You have posted…

Q: The main products of the light dependent reactions are: O water and carbon dioxide ATP and NADPH O…

A: To determine: To determine the main products of the light dependent reactions

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…

Q: After Eating a pizza Tomatoes and Pizza Dough =Producers – 10,000 or 20,000 Cheese – Primary…

A: The food chain is the arrangement of organisms in a linear sequence in which the nutrients and…

Q: In a few short sentences, describe the most widely accepted hypothesis concerning the evolution of…

A: Humans are different from other animals in many characteristics such as walking on two feet…

Q: How does Red Queen Hypothesis cause an evolutionary race with coronaviruses and mammalian species

A: RED QUEEN HYPOTHESIS - The Red Queen hypothesis was coined in evolutionary biology to explain that a…

Q: (Carrying capacity of humans) What is the difference in the carrying capacity of humans with other…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Account for the success of parasitic protozoans. Cite specific strategies employed by these…

A: Protozoa are the microorganisms visible under microscope. They are unicellular and Eukaryotic…

Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…

A: Please follow step 2 for detailed explanation.

Q: Modern humans vary in the amount of Neanderthal DNA they carry in their genomes What geographic…

A:

Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…

A: Vaccination : A biological preparation that can be used to activate the immune response in the body…

Q: To examine: Whether the statement "most intracellular signaling pathways provide numerous…

A: The intracellular signalling network is made up of several signalling pathways that carry…

Q: What role does each component of the ear play in transmitting vibrations that enter the outer ear…

A: The ear is a vital organ that is responsible for both hearing and maintaining body balance. The…

Q: NSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the…

A: The genome of a cell carries various genes that code for one or more proteins. The genes are coded…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.