At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?

At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?

Name: At least one nonsense suppressing tRNA is knownthat can suppress more
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense sup

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?
Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded by the mutant tRNA?
Yet another class of suppressor mutations not described in the chapter are mutations in tRNA genesthat can suppress frameshift mutations. What wouldhave to be true about a tRNA that could suppress aframeshift mutation involving the insertion of a singlebase pair?
If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?
If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?
A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different? Speculate: is this mutation more likely to be beneficial or harmful?
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or lysine, how does it work ?
We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?
Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith A in the wobble position? (Assume this A isalways modified to I.)b. In human tRNAs, what are the sequences of allpossible anticodons that were originally transcribedwith U in the wobble position? (Note: Any singletype of tRNA with a U at the wobble position canbe modified only in a single way.)c. How might the wobble Us in each of the anticodonsin (b) be modified and still be consistent with thegenetic code?d. What is the theoretical minimal number ofdifferent tRNA genes that must exist in thehuman genome? (Assume that xo5U pairs with A,G, or U only.)
The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.