BIO 211 Bacteriology Self Study: Use your text and lecture notes as reference to complete the table. Keep it brief as it is meant to help you study. Pathology Other Habitat Virulence Organisms Carbuncle, furuncle, food poisoning, TSS, scalded skin Gram (+) Cocci Beta hemolysin, enterotoxin A, TSST, exfoliatin, coagulase Skin, mucous Nosocomial, MRSA Staphylococcus Coagulase (+) S. aureus membranes Staphylococcus Coagulase (-) S. epidemidis S. pyogenes (Group A) Streptococcus Beta hemolytic S. agalactiae (Group B) S. mutans (viridans) Streptococcus Alpha hemolytic S. pneumoniae E. faecalis (Group D) Enterococcus Gamma hemolytic Gram (-) Cocci N. gonorrhoeae Neisseria N. meningitidis

Question
BIO 211 Bacteriology
Self Study: Use your text and lecture notes as reference to complete the table. Keep it brief as it is meant to help you study.
Pathology
Other
Habitat
Virulence
Organisms
Carbuncle, furuncle,
food poisoning, TSS,
scalded skin
Gram (+) Cocci
Beta hemolysin,
enterotoxin A, TSST,
exfoliatin, coagulase
Skin, mucous
Nosocomial, MRSA
Staphylococcus
Coagulase (+)
S. aureus
membranes
Staphylococcus
Coagulase (-)
S. epidemidis
S. pyogenes
(Group A)
Streptococcus
Beta hemolytic
S. agalactiae
(Group B)
S. mutans
(viridans)
Streptococcus
Alpha hemolytic
S. pneumoniae
E. faecalis
(Group D)
Enterococcus
Gamma hemolytic
Gram (-) Cocci
N. gonorrhoeae
Neisseria
N. meningitidis
Expand
Transcribed Image Text

BIO 211 Bacteriology Self Study: Use your text and lecture notes as reference to complete the table. Keep it brief as it is meant to help you study. Pathology Other Habitat Virulence Organisms Carbuncle, furuncle, food poisoning, TSS, scalded skin Gram (+) Cocci Beta hemolysin, enterotoxin A, TSST, exfoliatin, coagulase Skin, mucous Nosocomial, MRSA Staphylococcus Coagulase (+) S. aureus membranes Staphylococcus Coagulase (-) S. epidemidis S. pyogenes (Group A) Streptococcus Beta hemolytic S. agalactiae (Group B) S. mutans (viridans) Streptococcus Alpha hemolytic S. pneumoniae E. faecalis (Group D) Enterococcus Gamma hemolytic Gram (-) Cocci N. gonorrhoeae Neisseria N. meningitidis

Expert Answer

1 Rating

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Microbiology

Medical Microbiology and Virology

Antimicrobial Therapy

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Which of the following statements regarding constipation is TRUE?A. Constipation is defined as havin...

A: Constipation refers to bowel movements that are infrequent or hard to pass. The stool is often hard ...

Q: If you use the pUC18 vector  to clone in the MCS region, predict the following: a) Do bacteria that ...

A: pUC18 [plasmid of the University of California],  is a bacterial plasmid that was derived from pBR v...

Q: Why are the genes that encode these antigens so variable?

A: Immunity can be defined as the presence of different components involved in different mechanisms for...

Q: describe the difference between pain and other somatic sensations  describe the similarities between...

A: Pain is a distressing feeling often caused by intense damaging stimuli. Somatic sensations are sensa...

Q: In the introduction to this chapter, we discussed the role of famine during early prenatal developme...

A: The central nervous system (CNS) appears at the beginning of the third week as a slipper-shaped plat...

Q: What caused the drastic decline of theIllinois greater prairie chicken population?

A: Greater prairie chicken, commonly known as boomer due to its unique mating ritual known as booming. ...

Q: What is the query and what is searched using BLASTN? What is the query and what is searched in BLAST...

A: BLAST stands for the basic local alignment search tool. It is a search engine mainly for nucleotide ...

Q: What is the fundamental basis for the differences between largecarbohydrates, proteins, and nucleic ...

A: Polymers are long molecule structures that are made up of similar building blocks called as monomers...

Q: Do octopus and squids have exoskeleton?

A: An exoskeleton is an outer cover present on the body of an animal. In most of the animals it is made...

Q: What means universal donor vs universal recipient in blood dontation

A: Blood is a special connective tissue which has a fluid nature and is composed of fluid matrix, plasm...

Q: What are the stomach lining cells and specify specific functions of each?

A: The stomach refers to the part of the digestive tube present in the middle of the esophagus and smal...

Q: Which of the terms in the following pairs is correctly matched? Group of answer choices Heart contra...

A: Let us first understand the concept before matching A. Systole occurs when the heart contracts to pu...

Q: Define ectoparasite and endoparasite and give suitable examples.

A: Parasite is an organism that lives in or on an organism of another species and benefits by deriving ...

Q: WHY WOULD A FRACTURE IN THE ANTERIOR TEMPORAL BONE CAUSE JAW PAIN?

A: The temporal bone is a paired bone of the skull located at the lateral side and part of the floor of...

Q: Describe how bacteria reproduce asexually and sexually.  Be sure to address the processes of budding...

A: Bacteria are prokaryotic, unicellular, microscopic organisms. They lack a nucleus and membrane-bound...

Q: In which one of the following animals is skin a respiratory organ?   A. CockroachB. FrogC. sharkD. W...

A: different animals can exchange gases through different respiratory systems such as, Through Body Wa...

Q: In a microarray experiment, if you label cDNA from Tissue #1 with a red color and cDNA from tissue #...

A: Microarray is the laboratory tool which is used to detect the expression levels of hundreds of genes...

Q: What are nymph and imago?

A: Nymph and imago are the developmental stages of insects.

Q: what influences a child to play with a doll versus a truck, or what influences a child to engage in ...

A: There are various theory and model regarding child’s behavior. There is still debate among developme...

Q: Would the genomic conflict hypothesis be likely to explain genomic imprinting for genes involved in ...

A: What is genomic imprinting? In mammals, some embryonic genes are expressed differently depending on ...

Q: In competition, individuals seek to acquire the samelimiting resources. For example, snow geese and ...

A: Darwinism states thst through a population tends to increase geometrically the food increases only a...

Q: . Identify the theme or themes exemplified by (a) thesharp quills of a porcupine, (b) the developmen...

A: Biology is the scientific study of life and its related biological aspects. The interactions among l...

Q: Consider that two bacteria produced by binary fission do not have the same phenotype. The most likel...

A: A mutation is the process of permanent genetic alteration of the DNA of an organism which results in...

Q: Phenytoin (sodium channel blocker) and ethosuximide (calcium channel blocker) are anti-seizure drugs...

A: Electrical signals regulate the contraction of muscle, secretion of hormones, sensation of the envir...

Q: what role microbiologists can and have played in helping to reduce the number of infections caused b...

A: Helminths are the term used for parasites that look like a worm. They live on a host and take nutrit...

Q: Draw plant, animal and prokaryotic cells with its organelles (for those that have them) and define t...

A: A cell is the smallest unit of life. They are often called the building blocks of life. Cells can ei...

Q: What is a biodiversity hot spot?

A: The term biodiversity describes the huge variety of life forms on Earth. It is the variety and varia...

Q: what bone get injured on the ankle fracture

A: A broken ankle is also called a fractured ankle. It happens when one or more bones in the ankle  joi...

Q: Which of the following would increase the resistance to blood flow? Group of answer choices All of t...

A: Blood is a fluid connective tissue that flows in the vessels of the circulatory system. Certain forc...

Q: A bacterial cell is mutated and cannot create the repressor protein associated with the Lac operon. ...

A: Lac operon is associated with uptake and metabolism of lactose.

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom ...

A: Transcription is the first step of central dogma or simply gene expression in which the DNA sequence...

Q: When taking a person’s blood pressure Group of answer choices The last sound of Korotkoff is heard w...

A: Blood pressure is the force/pressure of the blood pushing against the walls of the blood vessels. Wi...

Q: Calculate how much the PCB concentration increased at each step in thefood web.

A: PCB or Polychlorinated biphenyls  PCBs are very stable mixtures that are resistant to extreme temper...

Q: How is diapause different from hibernation?

A: Few species undergo adaptations to avoid unfavourable conditions in space by migration or in time by...

Q: Within each year, what is the pattern of change in CO2 concentration? Why might this pattern occur?

A: Carbon dioxide is an important constituent of the atmosphere and one of the major gases present in t...

Q: Hello, Toddler presents the following: Extreme alertness or always looking around; Need for less sl...

A: From the given information in the case study, The toddler is considered as Gifted children. The Gift...

Q: A person’s blood pressure is measured at 118/78 and the person’s peripheral pulse is 72. Which of th...

A: Blood pressure is defined as the pressure applied by the blood flowing in the arteries against the a...

Q: Distinguish between the hibernation and aestivation.

A: The importance of the sleep is mainly related to the conservation of energy of one’s body, survival ...

Q: Identify the classification of the following blood pressure: 125/85. Group of answer choices Stage 2...

A: Blood pressure:   Heart pump blood which moves all around the body and provides oxygen and nutrition...

Q: A collection of all the alleles of all the genes of a crop plant are called?

A: All the alleles of all the genes of a crop plant is collected in plant breeding to evaluate the requ...

Q: You are planning to set up of dairy farm.describe the various aspects you would consider before you ...

A: A dairy farm is a farm where milk is produced, packed and sold into the market for commercial purpos...