ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein synthes ion of DNA template strand is shown below TCCAAATTGTTGCCCG-3' rite down the sequence of amino acids formed when tion of DNA is transcribed and translated. e standard (coding strand) base triplets TAA, TAG ar 4 do not correspond with an amino acid. Write down the corresponding mRNA codons for base triplets.

ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein synthes ion of DNA template strand is shown below TCCAAATTGTTGCCCG-3' rite down the sequence of amino acids formed when tion of DNA is transcribed and translated. e standard (coding strand) base triplets TAA, TAG ar 4 do not correspond with an amino acid. Write down the corresponding mRNA codons for base triplets.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 5P

See similar textbooks

Similar questions

a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?