Calculate the transformation efficiency of an experiment conducted using 10µl of 0.005µg/µl plasmid, you plated 100µl out of a total volume of 500µl and the count of transformed colonies was 186.

In an restriction enzyme experiment where Eco RI and  Hind III are used . What would happen if a third restriction enzyme, BamHI were used in this lab if there was only one site on the plasmid that is recognized by BamHI? Explain what difference you would see in the gel

add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…

SDS polyacrylamide electrophoresis was used to determine of the sizes of the wild type and Mutant 1 and 2 HOAP proteins expressed from these plasmids in bacteria. Using the Protein Standards as a guide, estimate the sizes of the HOAP protein expressed from each plasmid. 250 100 75 50 25 10