
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
thumb_up100%
Calculate the transformation efficiency of an experiment conducted using 10ul of 0.005 ug/ul plasmid, you plated 100ul out of a total volume of 500ul and the count of transformed colonies was 186.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You want to infect a plate of 2x10^6 HeLa cells with poliovirus at an MOI of 10. Your viral stock is at concentration of 8x10^7 particles/ml. What volume of your viral stock do you need to apply to your cells? Show your workingarrow_forwardadd 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…arrow_forwardSDS polyacrylamide electrophoresis was used to determine of the sizes of the wild type and Mutant 1 and 2 HOAP proteins expressed from these plasmids in bacteria. Using the Protein Standards as a guide, estimate the sizes of the HOAP protein expressed from each plasmid. 250 100 75 50 25 10arrow_forward
- 17 A nutrient agar plate labeled 10-5 mL produced 154 colonies after incubation. a. What was the cell density in the original sample? ET b. What combination(s) of volumes and dilution factors could have been used to inoculate this plate? A nutrient agar plate labeled 10-7 mL produced 62 colonies after incubation. a. What was the cell density in the original sample? b. What combination(s) of volumes and dilution factors could have been used to inoculate this plate? The original cell density in a sample is 2.79 x 100 CFU/mL. Which sample volume should yielda countable mL.) plate? (Express your answer as 10 20 The original cell density in a sample is 5.1 x 10° CFU/mL. Which sample volume should yield a countable plate? (Express your answer as 10 mL.) 21 A sample has a density of 1.37 x 105 CFU/mL. a. What sample volume should yield a countable plate? b. Which two dilution tubes could be used to produce this sample volume? How? 22 A sample has a density of 7.9 x 10° CFUlmL. a. What sample…arrow_forwardstep by step calculations pleasearrow_forwardAssume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a pUC18 cloning vector. Describe the appearance of transformed colonies you would expect to see on each of the following plates: plain media, media containing ampicillin, media containing tetracycline, media containing ampicillin and X-Gal.arrow_forward
- The modifiedplasmid is reintroduced back into Rhizobium(step 4) and the genetically transformed bacteria are then selected based on the amp and lacZgenes present within the plasmid. The plasmid may or may not integrate the BBW resistancegene. The treated bacteria may or may not take up the modified plasmid. a) Complete the table below with a yes or no in each space stating whether you would expect these bacteria to grow or not. Type of treated bacteria culture plate(no amp) Culture plate treated with ampicillin Plasmid not taken up Plasmid taken up (WithoutBBW resistancegene) Plasmid taken up (WithBBW resistancegene) B) Outline how the genetically transformed bacteria containing the BBW resistance gene can beselected based on the amp and lacZgenes present within the plasmid.arrow_forwardEcoRI 1.1kbp 1.5 kbp Hindll Hindll 0.15 kbp amp 0.25 kbp EcoRI If you were to digest this plasmid with HindllI, how many fragments would be visible using gel electrophoresis? O 1 O 4arrow_forwardCan this standard curve be used for E. coli cells (why/why not?)arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education