Chromatin remodeling is linked to epigenetics.  Explain how this works and indicate the driving factors for this process

Q: What would be an example of humoral stimuli on a hormonal level? Would transport functions that incl...

A: The three stimuli that control the endocrine glands for the synthesis and secretion of hormones are ...

Q: what is medullary papilla?

A: The organ system in a body that functions to excrete the waste out of the body is termed as the excr...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: These questions have more to do with animal biology. What is tail docking in general? and then what ...

A: Tail docking:Tail docking refers to the amputation or removal of a portion of animal’s tail, commonl...

Q: 7. True or False? Censoring occurs when the event of interest (e.g., disease status) is observed on ...

A: Click to see the answer

Q: what is the difference between chromatid and chromatin?

A: Chromatids and chromatins are components of genetic materials or chromosome of a eukaryotic organism...

Q: What are the two ways environmental signals promote a cellular response. what cellular process is ta...

A: The binding of chemical signals to their corresponding receptors induces events within the cell that...

Q: The Gardasil 9 vaccine prevents infection by all types of human papillomaviruses. True or False

A: The given statement is false.Human papillomaviruses (HPV) cause sexually transmitted diseases that c...

Q: Why must starch be hydrolyzed before it can be used as an energy source or transported?

A: Carbohydrates are the sugars that include monosaccharides (simple sugars) and polysaccharides. Starc...