Question
Asked Jan 26, 2020
10 views

Chromatin remodeling is linked to epigenetics.  Explain how this works and indicate the driving factors for this process

check_circle

Expert Answer

Step 1

Epigenetics is referred to as the study of phenotype changes that are inheritable and does not involve any alteration in the ...

Want to see the full answer?

See Solution

Check out a sample Q&A here.

Want to see this answer and more?

Solutions are written by subject experts who are available 24/7. Questions are typically answered within 1 hour.*

See Solution
*Response times may vary by subject and question.
Tagged in

Science

Biology

Related Biology Q&A

Find answers to questions asked by student like you
Show more Q&A
add
question_answer

Q: What would be an example of humoral stimuli on a hormonal level? Would transport functions that incl...

A: The three stimuli that control the endocrine glands for the synthesis and secretion of hormones are ...

question_answer

Q: what is medullary papilla?

A: The organ system in a body that functions to excrete the waste out of the body is termed as the excr...

question_answer

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

question_answer

Q: These questions have more to do with animal biology. What is tail docking in general? and then what ...

A: Tail docking:Tail docking refers to the amputation or removal of a portion of animal’s tail, commonl...

question_answer

Q: 7. True or False? Censoring occurs when the event of interest (e.g., disease status) is observed on ...

A: Click to see the answer

question_answer

Q: what is the difference between chromatid and chromatin?

A: Chromatids and chromatins are components of genetic materials or chromosome of a eukaryotic organism...

question_answer

Q: What are the two ways environmental signals promote a cellular response. what cellular process is ta...

A: The binding of chemical signals to their corresponding receptors induces events within the cell that...

question_answer

Q: The Gardasil 9 vaccine prevents infection by all types of human papillomaviruses. True or False

A: The given statement is false.Human papillomaviruses (HPV) cause sexually transmitted diseases that c...

question_answer

Q: Why must starch be hydrolyzed before it can be used as an energy source or transported?

A: Carbohydrates are the sugars that include monosaccharides (simple sugars) and polysaccharides. Starc...