Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?

Q: IV. CENTRAL DOGMA OF MOLECULAR Suppose the following base sequence was found in a 30-base polymer:…

A: Central Dogma:  Central dogma is a process by which information from DNA is converted into…

Q: In problem 2e, how can you identify added mutations?

A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: 3⁰ A 5 A GC G G A UA A/C UGU P Examine the tRNA above. Which codon on the mRNA strand codes for this…

A: The translation is the process by which polypeptide chain or protein is synthesized from the mRNA…

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…

A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: The central dogma of life involves DNA replication, transcription, and translation into proteins.…

Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…

A: Thank you for the question  Answer The Genes code for proteins. These proteins are the workhorse of…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A.…

A: Introduction Genetic code or codon is a three letters nucleotide bases present on m RNA which code…

Q: Explain why the glucocorticoid receptor binds next to the core promoter of some genes, but not next…

A: Glucocorticoids are corticosteroids that are a class of steroid hormones. They are the…

Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…

A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…

Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…

A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…

Q: Transcription/Translation Practice WS MRNA TRNA Amino AUU GUA His Acid DNA ATA ССА MRNA ERNA UUC Trp…

A: Central dogma explains the flow of genetic information from DNA to RNA to proteins.  The process of…

Q: DNA Leading strand: 5' AAA ATA | CGC TTT|TTA ATT| AAC CCC GGG 3' A | B| C I D Exons: A, C, D…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…

A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…

Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…

A: Mutations are changes that occurs in nucleotide sequence of DNA.The types of mutation are:…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…

A: Introduction:  DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…

Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: Incorrect statement about m-RNAa) Cap is added to the 5’ endb) Introns are removed and exons are…

A: Posttranscriptional modifications are changes that occur to a newly transcribed primary RNA…

Q: sectio (b) The standard (coding strand) base triplets TAA, TAG an TCA do not correspond with an…

A:

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: vhat RNA amino acid sequences does the coding strand speciry? Coding strand: Template strand: RNA:…

A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…

Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…

A: DNA is two stranded structure which make it own strand via  replication process . It comprises of…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…

A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: Basisse triplet nommer/ Base triplet number  1  2  3  4  5  6  7  Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50 Each bacterial…

A: Eukaryotes have mainly three types of RNA polymerases that transcribes different types of RNA. RNA…

Q: = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription…

A: Transcription is the process which consists of several steps of DNA-based gene expression. Here a…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: Anticodon Anticodon Anticodon 3 1 5'-IAG-3' 5'-UAU-3' 5'-AAA-3' codon MRNA 5'- -3' 5' _3' 3' 5' 3. 1…

A: Multiple subparts are there in question. I will answer first 3 subparts, as per guidelines. In RNA,…

Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…

A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…

Q: Transcribe this sequence of DNA into mRNA. 5' ACG AGC TAG CCT 3 3' TGC TCG ATC GGA 5' <- template…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: mutation each as Deletion, Insertion or Substitution AND as either , missense, silent or nonsense…

A: In this question, we have to identify the type of mutation in the given DNA sequence.

Q: Original DNA ЗТАС ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that act as genetic…

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…