Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…
A: The three main processes of central dogma of molecular biology are replication, transcription, and…
Q: Answer for 1 ,2,and 3 asap
A: Answer given in steps 2 onwards. Please find the attachment. Thank you
Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…
A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…
A:
Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…
A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…
Q: In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino…
A: Once a gene is transcribed into a pre-mRNA transcript containing both coding (called as exons)…
Q: Fill in the following information for making the following polypeptide (the codon chart is below).…
A: The sequence of nucleotides in DNA or RNA makes up the genetic code. Codons are three-base groups…
Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…
A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…
Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…
A: Mutation is defined as the change in the nucleotide sequence of DNA.
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: The following is the base sequence of an exon portion of a template strand of a DNA molecule: 5'…
A: Introduction :- DNA acts the genetic material , present within the nucleus of a cell . It is a…
Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…
A:
Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…
A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…
Q: Use the table below to help you answer the following question. THE CODON TABLE FIRST POSITION SECOND…
A: Ans- Tyrosine was replaced with cysteine.
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…
Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…
A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…
Q: Translate the following mRNA codons: 5' AAG UGG CAU ACG - 3' Write your answer in order (first codon…
A: Translation in molecular biology is the process by which the RNA of the cell is read and comment…
Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: AA DNA strand DNA strand mRNA codon B tRNA anticodon Amino acid I Alanine CGT ACG CTC TAG CCA !!!! U…
A: Introduction DNA replication is the process through which cells make copies of the genome's DNA. A…
Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…
A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…
Q: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct…
A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…
Q: The first column of the table below shows the beginning of a gene and five different mutations of…
A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…
Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…
A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…
Q: How many initiation codons are there? a. 1 b. 3 c. 4 d. 20
A: Genetic codon or triplet codon basically serves the function of protein translation. Ribosomes are…
Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…
A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…
Q: What do you call the process of making chains of polypeptides out from RNA strand? Group of answer…
A: Nucleic acids are defined as the type of natural chemical compounds that play a major role in…
Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?
A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…
Q: Use the DNA sequence above, list all possible splicing products
A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…
Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…
A: The process of making a protein from the information contained in a molecule of messenger RNA is…
Q: Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…
A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…
Q: D. Which letter in the diagram above best corresponds to the location where exons are found? O A O C…
A: The method of producing RNA copies of a genetic sequence is known as transcription. This duplicate,…
Q: Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser
A: Codons are the triplet base of the nucleotide sequence, which encodes the amino acids during…
Q: Locate as accurately as possible the listed items that are shown on the following figure. Some items…
A: The diagram shown indicates protein synthesis , process known as translation .
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic…
A: Cells are the building blocks of life. They are the constituent structural and functional units of…
Q: Please write a paragraph and include an image about Translation and use the following terms (in the…
A: The deoxyribonucleic acid (DNA) is the genetic material in most organisms (a few viruses have RNA as…
Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…
A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: Transcription is a process through which the double stranded DNA transcribes itself into a single…
Q: Define the following terms:a. codonb. anticodonc. genetic coded. open reading framee. codon usage…
A: Molecular genetics is a sub-field of biology that addresses how differences in the structures or…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 10.9 the beginning of a gene and five different mutations of this the base-pairing rules to complete…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from…
A: RNA splicing process helps to translate mRNA into protein.
Q: Define the following terms: a. transcript b. proteome c. metabolome d. double helix e. base stacking
A: The DNA is the genetic material in the cell, which has a double helix configuration and these…
Complete the following chart.
Region Length Multiples of 3? Intron 1
Intron 2
Exon 1 (from start)
Exon 2
Exon 3 (to stop)
Exon Total
RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with nitrogenous base, and phosphate molecules.
Step by step
Solved in 2 steps with 2 images
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNABriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
- Using the mRNA codon table below and your knowledge of transcription and translation, complete this information: DNA Sequence: 5' ATG GAA 3' non-template strand DNA Sequence: 3' TAC ATA 5' mRNA sequence 5' 3' amino acid sequence: Met CComplete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino acid code A T G A A A G T C A T T T A GPlease write a paragraph and include an image about Translation and use the following terms (in the paragraph): ribosomal attachment, 5’ end, start codon, codons, genetic code, tRNA, stop codon
- Complete the follow table and answer the next two questions. DNA____strand: ___ / T _ _ / _ _ _ / A _ _ / G _ _ DNA____ strand: _ _ _ / _ _ G / _ _ _ / _ _ G / _ C _ mRNA codon: _ _ _ / _ _ _ / _ _ G / _ _ _ / _ _ U tRNA anticodon: _ _ U / _ C _ / _ _ _ / _ A _ / _ _ _ Amino Acid: Alanine / ___ / Glutamate / ___ / ___ CGT ACG CTC TAG CCAComplete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication Transcription translationRefer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somatic
- Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome, plays a structural role;as a ribozyme, plays a catalytic role(catalyzes peptide bond formation) Primary transcript Small RNAs in the spliceosomeComplete the phrases with the correct word or words. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. methionine b. ribosome c. codon d. AUG e. UAC The mRNA moves out of the nucleus and attaches to a The first codon of an mRNA molecule is always As soon as the first codon is in place, a tRNA molecule arrives with the anti-codon The first tRNA to arrive always carries the amino acid called, The ribosome scoots along the mRNA to read the nextDrag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2. Codon 3. mRNA 4. Ribosome 5. tRNA
