Consider a disease that arises from incorrect DNA replication. describe the disease and the ways in which these errors lead to physiological consequences.

Q: Discuss about Nuclear positionAnaphase onset

A: Mitosis is a cell division type and the cell is divided into two identical cells in this process.…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Match the mutation type with the correct example.

A: Mutation is any alteration or modification or change in the nucleotide sequence, resulting in a…

Q: Describe the impact a carcinogen has on a cell.

A: The cells of the body grow and divide the cell division inside the body require some signals. They…

Q: Describe how tumors are diagnosed.

A: An abnormal mass of tissue that forms once cells grow and divide quite they {should|they ought…

Q: List genetic diseases that is caused or influenced by the exposure of radiation

A: Answer :- There are genetic diseases that is caused or influenced by the exposure of radiation are…

Q: . Defend the statement “Cancer is a genetic disease.”

A: Introduction  Cancer is well known disease now a day. In US, 1 in 2 women and 1 in 3 men develops…

Q: In which phase does DNA replicate

A: Cell division is the result of a sequence of processes that take place within the cell. The cell…

Q: Define histones.

A: The eukaryotic cell contains DNA inside its nucleus. The long DNA is compacted into such a small…

Q: Explain why cell injury due to genetic causes are alarmingly increasing each year.?

A: Cell injury is damage in the cell that occurs due to some external and internal…

Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…

Q: suggest reasons for why DNA mutations are not all phenotypic.

A: Mutation is a change in nucleotide sequence of DNA which can occur either due to mistakes during DNA…

Q: Discuss  Nuclear positionAnaphase onset

A: The cell is the primary fundamental unit of life, which is self-contained. It increases in number…

Q: Why are bone marrow stem cells ideally suited as targets for gene therapy?

A: Bone marrow stem cells are widely suited as targets for gene therapy because they provide two major…

Q: A subset of colorectal cancers is associated with mutations in the Mut genes which code for proteins…

A: There are some Mut enzymes that check the identity of newly formed DNA and if there are certain…

Q: what would be the likely effect of a mutation that prevented the formation of memory cells?

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: Give an examples of genetic diseases.

A: A genetic disorder or genetic disease is a condition that occurs because of any defect or change in…

Q: In denaturation of DNA and protein explain how denaturation brings about the ailment and what its…

A: Protein Denaturation:                     A cell death is symbolized by the advent consequence of…

Q: Describe DNA Damage: Definition: Define DNA damage. What are some causes of DNA damage? What…

A: (a) DNA damage as the term suggest is the abnormal chemical structure in the DNA molecule. It is…

Q: Describe PMCA and cancer

A: Cancers are known to be the state of the cells in which the cells divide uncontrollably due to…

Q: In 1-2 sentences, explain why mutations can be beneficial to an organism.

A: A mutation is a sudden and abrupt change in the structure and function of the chromosome.

Q: Explain what a mutation is and how it can cause a genetic disease.

A: Every cell after a certain growth and development it divides. Cell division occurs follwed by…

Q: Explain about Gene Mutations and Cancer ?

A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…

Q: Explain the process that damages DNA has the potentialto be carcinogenic ?

A: The cells have developed various mechanisms for DNA (deoxyribonucleic acid) damage repair that is…

Q: Explain the difference between mutation and DNA damage.

A: DNA is deoxyribonucleic acid. It is the genetic material and is responsible for carrying genetic…

Q: Identify cancers that are the result of chronic inflammation.

A: Inflammation is a nonspecific immune response to the presence of antigens in the body.

Q: Give an example for apoptosis, necrosis, or autophagy.

A: Apoptosis is also known as programmed cell death. It occurs during embryogenesis, metamorphosis, and…

Q: utations and the effects of genetic mutation

A: Mutation can be defined as the change in the DNA sequence. The process of Mutations can result from…

Q: Elaborate on DNA capabilities

A: DNA or deoxyribonucleic acid is a macromolecule composed of two polynucleotide chains that coil…

Q: B. Write a paragraph on the importance of DNA availability and the impact it has on Protein…

A: DNA is deoxyribonucleic acid (genetic material) found in all living cells. In prokaryotes, it is…

Q: Identify An illness characterized by mutations that disrupt normal control mechanisms and produce…

A: Alterations to the DNA sequence that make up a gene are known as mutations. Environmental influences…

Q: Explain the process called called depurination?

A: The genetic material of the organism contains coded information in the form of nucleotide sequence,…

Q: Define cancer

A: A disease is an abnormal condition that affects the structure or function of an organism and is…

Q: Discuss types of DNA damage and how such lesions can be repaired.

A: Mutations arise not only from errors in replication but also through the damage in DNA. Some damage…

Q: Explain how a missed cell cycle checkpoint results in cancer. (in 5 sentences)

A: Answer. The cell cycle is a highly regulated and dependent series of events, mediated by a number of…

Q: List the Major common cause of Cell damage

A: Cell In biology, a cell is a membrane-bound unit that contains the basic molecules of life and is…

Q: Explain the using of Genetic Techniques to Treat Disease.

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA. DNA stands for…

Q: Describe the Cancer stage grouping

A: Cancer is seen in that cell which don't follow normal cell cycle.

Q: Define DNA marker

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms. Deoxyribonucleic acid is…

Q: (c) Discuss the process of replication of DNA.

A: When a cell divides, DNA replicates itself via the process of replication.

Q: Explain the possible repercussions to an organism, when a mutation occurs in the genome?

A: Mutation   The change or variation occurs in the sequence of DNA is known as mutation. In mutation…

Q: Define molecular marker.

A: Molecular methods use genetic mapping to pinpoint and identify the position of a particular gene on…

Q: Explain about treatment of cancer.

A: Cancer is a disease which involves abnormal cell growth with the potential to spread or invade to…

Q: DEscribe the term disease genes

A: Genetic is a branch of science that deals with genes, DNA, alleles, genetic variation, heredity, and…

Q: Define and Cancer ,differentiate between a benign tumor and amalignant tumor, using examples.

A: Cancer is also known as malignancy and it is a disease in which abnormal growth of cells takes place…

Q: Analyze and describe the different types of  genetic mutations and their effects. Then discuss, in…

A: A gene is a DNA sequence that contains genetic information for one functional protein. Disrupting…