Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹What is the sequence of amino acids in the translated protein?Second letterAFirst letterСUdAGบบบUUC PUUUAUUG LeuCUUCUCCUACUGGUUGUCGUAGUG-PheMet-Ser-GlnMet-Arg-Lys-SerLeuStop-Cys-Arg-Asn-AsnCAUUAUC lleAUAACAAUG Met ACGValUCUUCCUCAUCGCCUCCCCCACCGACUACCGCUGCCGCAGCGJSerProThrAlaUAUUAC TyrUGUUGC.UAA Stop UGA StopUAG Stop UGG TrpCACCAGGinCAU HisSelect an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.AAU AsnAAALysAAG.There is no start codon, resulting in no translated protein.GAU ASPGACGluGAAGAGGCGUCGCCGACGGCysAGUAGCAGAAGG ArgGGUGGCGGAGGGJArgserGlyMCAGUUCAGсАSCAGUSCAGUThird letter

Gene is a hereditary unit which helps in transfer of genetic information. Genetic information is…

Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter U A G UUC Phe UUA UUG U UA}Leu CUUT CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC GUA GUG Met-Ser-Gln Leu С Met-Arg-Lys-Ser - Val Stop-Cys-Arg-Asn-Asn C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC Tyr UAA Stop UGA Stop UAG Stop UGG Trp CACHIS CAGGIN AAU AAC Asn AAA AAG. Lys Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. GAU ASP GACJ d There is no start codon, resulting in no translated protein. GAA GAG G UGC Cys CGU CGC CGA CGG Arg AGU Ser AGC. AGA AGG Arg GGU GGC GGA GGG Gly MCAC G SCAG SCAG SCAG U Third letter

Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter U A G UUC Phe UUA UUG U UA}Leu CUUT CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC GUA GUG Met-Ser-Gln Leu С Met-Arg-Lys-Ser - Val Stop-Cys-Arg-Asn-Asn C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC Tyr UAA Stop UGA Stop UAG Stop UGG Trp CACHIS CAGGIN AAU AAC Asn AAA AAG. Lys Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. GAU ASP GACJ d There is no start codon, resulting in no translated protein. GAA GAG G UGC Cys CGU CGC CGA CGG Arg AGU Ser AGC. AGA AGG Arg GGU GGC GGA GGG Gly MCAC G SCAG SCAG SCAG U Third letter

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Given the following mRNA sequence, what is the amino acid sequence of the polypeptide that will be produced in the cell? 5’ – CGAGGUAUGCCAACGUGCGUCUAAUCCCGA-3
What potential polypeptides can be produced from the following mRNA sequence? There are more than one answer.. 5’ ...GGAGCUCGUUGUAUU... 3’ a. ser-ser-leu-tyr b. leu-cys-cys-ser-arg c. gly-ala-ser-trp-ile d. gly-ala-arg-cys-ile e. glu-leu-val-val f. You can't translate without a start codon. I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________