D A mutation in the Pitx1 gene prevents normal hindlimb formation in mouse embryos. Analyses of the presence and length of the gene, its mRNA transcript, and the protein produced show the following results: DNA sequence: normal length mRNA: present, normal length protein: present, shorter than normal Which of the following is the most likely explanation for the mutation? Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. The mutation removes a transcription factor binding site in a cis-regulatory region of Pitx1. a с It is a nonsense mutation in the Pitx1 coding region that changes a codon for an amino acid into a stop codon. It is a missense mutation in the Pitx1 coding region that changes a single amino acid. d It is a mutation in an enhancer that prevents a transcription factor from binding.

D A mutation in the Pitx1 gene prevents normal hindlimb formation in mouse embryos. Analyses of the presence and length of the gene, its mRNA transcript, and the protein produced show the following results: DNA sequence: normal length mRNA: present, normal length protein: present, shorter than normal Which of the following is the most likely explanation for the mutation? Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. The mutation removes a transcription factor binding site in a cis-regulatory region of Pitx1. a с It is a nonsense mutation in the Pitx1 coding region that changes a codon for an amino acid into a stop codon. It is a missense mutation in the Pitx1 coding region that changes a single amino acid. d It is a mutation in an enhancer that prevents a transcription factor from binding.

Name: 1 Please answer this asap 口A mutation in the Pitx1 gene prevents norma
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1 Please answer this asap 口A mutation in the Pitx1 gene prevents normal hindlimb formation in mouse embryos. Analyses of the presence and length of thegene, its mRNA transcript, and the protein produced show the following results:DNA sequence: normal

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
The TBX20 transcription factor is important for the developmentof heart tissue. Deletion of the Tbx20 gene in mice results in poorheart development and the death of mice well before birth. Tobetter understand how TBX20 regulates heart development ata genetic level, Sakabe et al. (2012. Hum. Mol. Genet. 21:2194–2204) performed a transcriptome analysis in which they comparedthe levels of all mRNAs between heart cells from wild-typemice and mice with Tbx20 deleted. This study concluded that TBX20 acts as an activator ofsome genes but a repressor of other genes in cardiac tissue.How might a single transcription factor have oppositeeffects on the transcription of different genes?
A graduate student studying yfgA expression in the liver and heart performs an RNA-seq experiment. She aligns her sequencing reads to the human genome as shown. a.) What splice variants are expressed in the liver? Draw the mRNA and label the exons.b.) Are they expressed at the same levels in the liver? Explain c.) What splice variants are expressed in the heart. Clearly explain all the data from the figure. d.) In which tissue is the gene more highly expressed? Explain
Annotation of the human genome sequence reveals a discrepancy between the number of protein-coding genes and the number of predicted proteins actually expressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing more than 100,000 different proteins and perhaps three times this number. What is the discrepancy, and how can it be reconciled?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
In the sea urchin, early development may occur even in the presence of actinomycin D, which inhibits RNA synthesis. However, if actinomycin D is present early in development but is removed a few hours later, all development stops. In fact, if actinomycin D is present only between the sixth and eleventh hours of development, events that normally occur at the fifteenth hour are arrested. What conclusions can be drawn concerning the role of gene transcription between hours 6 and 15?
A genon wide analyst of human genome indicated that approximately 1500 genes encoded transcription factors that are important for sequence specific gene expression. based on this information approximately what percentage of the protein coding genes in human belong to the transcription factors? A. 15% B. 5% C. 7.5% D.1.5%
Describe the mechanisms in which DNA is used to generate protein. Reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
As we have learned in this chapter, the Nanos protein inhibits the translation of hunchback mRNA, lowering the concentration of Hunchback protein at the posterior end of a fruit-fly embryo and stimulating the differentiation of posterior characteristics. The results of experiments have demonstrated that the action of Nanos on hunchback mRNA depends on the presence of an 11-base sequence that is located in the 3′ untranslated region (3′ UTR) of hunchback mRNA. This sequence has been termed the Nanos response element (NRE). There are two copies of NRE in the 3′ UTR of hunchback mRNA. If a copy of NRE is added to the 3′ UTR of another mRNA produced by a different gene, that mRNA is repressed by Nanos. The repression is greater if several NREs are added. On the basis of these observations, propose a mechanism for how Nanos inhibits Hunchback translation.