Describe the actions of all of the enzymes involved in replication of aDNA molecule.

Q: Name of a few enzymes involved in DNA replication other than DSNA polymerase and ligase.name the key…

A: Each cell follows central dogma to undergo division and growth. The central dogma has three main…

Q: Define the term RNA polymerase?

A: Introduction  Transcription is the process of formation of RNA transcript form the segment of DNA…

Q: ___________ replication forks are created at the origin of replication.

A: Replication of DNA begins at a single origin of replication, two replication forks are formed which…

Q: Describe how cDNA is made.

A: A cDNA or complementary DNA (deoxyribonucleic acid) is produced from ssRNAs (single-stranded…

Q: What process would be affected by the lack of the en- zyme RNA polymerase?

A: DNA and RNA are the two types of nucleic acids present in living beings.

Q: State the function of histones in DNA packaging.

A: Histones are highly basic proteins because they are rich in lysine and arginine residues. They are…

Q: Name the process by which the information on DNA is copied into an RNA molecule.

A: Nucleic acids store and transmit hereditary information. There are two types of nucleic acids:…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Illustrate how DnaA initiates the DNA replication at origin of replication site.

A: Answer  DNA replication begins at a single origin of replication

Q: ) With the indication of sense strand, template strand, the direction of transcription, provide a…

A: the direction of the DNA template strand for transcription is  Strand elongation  DNA is…

Q: Describe initiation of translation

A: At the end of the transcription process, the translation process begins. The translation is the…

Q: List the substances required for replication of DNA catalyzed by DNA polymerase.

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: Explain the role of RNA polymerase.

A: RNA pol is an enzyme that's liable for the repetition of a DNA sequence into a ribonucleic acid…

Q: Describe the structural features of an origin of replication

A: A plasmid is circular, extrachromosomal, small piece of DNA present in the cytoplasm that is…

Q: Identify three ways transcription is different from replication.

A: Transcription: The formation of RNA take place from the template strand DNA. It occurs to form RNA…

Q: Describe in detail the process of translation and transcription.

A: Introduction : In the field of molecular biology, the path by which DNA's information is encoded…

Q: define DNA replication translation transcription, reverse transcription and how they are connected

A: DNA is the genetic material for almost all living organisms. It contains the information that is…

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: Describe in detail the semi Conservative replication of the DNA double helix structure

A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…

Q: Illustrate the mechanism of a semiconservative model of DNA replication.

A: The process by which the genome's DNA is copied in cells is known as DNA replication. Before…

Q: describe the Structure of Replication Forks

A: The process of DNA replication is the process by which the genetic material of the organism copies…

Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.

A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: Give an example of a concrete situation, in the human body, which would lead to DNA replication and…

A: DNA replication refers to the production of more copies of DNA using the available DNA as a…

Q: Explain the mechanism by which DNA is replicated.

A: DNA replication in prokaryotes is an essential mechanism to maintain the consistency of characters…

Q: Describe two ways by which DNA is released from cells.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Explain the DNA translation process

A: DNA Translation:                         The process of translating the sequence of a messenger RNA…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: Describe the process of translation of DNA to RNA.

A: DNA is the genetic materials of us.

Q: Explain the translation with its stages.

A: All cells use replication, transcription, and translation to keep track of their genetic material…

Q: Describe how the absence of the RNA polymerase enzyme affects the process.

A: RNA polymerase is an enzyme. It is used in the transcription process. The RNA polymerase binds to…

Q: List and describe the important proteins involved in transcription (that are found around the…

A: Introduction  Transcription: it is the formation of transcript or RNA, which can be coding or…

Q: Outline the major steps in the process of (indicate necessary enzymes for each): a. Replication…

A: The translation is usually defined as the way that they are been stated to process of creating…

Q: Name differences between replication and transcription.

A: Answer 1: Replication- Replication is the process of producing two identical copies of DNA from the…

Q: For transcription to occur, the promotor region of DNA will

A: Transcription Transcription is the process of synthesis of mRNA strand from DNA strand. In the…

Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…

A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…

Q: Describe in detail how the leading and lagging strands are synthesized concurrently during DNA…

A: A new strand of DNA is always synthesized in the 5' to 3' direction by the DNA polymerase enzyme.…

Q: Describe the critical role that complementary base-pairing plays in replication, transcription, and…

A: The nucleic acids have a property of complementary base-pairing. The nitrogenous base attached to…

Q: A _____________________ is a multienzyme complex thatsynthesizes RNA primers during E. coli DNA…

A: A multienzyme complex refers to the stable assembly of two or more enzymes that carries out a single…

Q: Compare and contrast DNA replication to transcription. Include required molecular components and…

A: Gene expression is the process by which the instructions in the DNA molecule are converted to…

Q: describe specifically how protein tertiary structure facilitates DNA replication.

A: Dna replication is duplication or synthesis of new daughter DNA from parent which is facilitated by…

Q: A _____________ is a multienzyme complex that synthesizes RNA primers in E. coli DNA replication.

A: In cell biology, replication is the process by which a ds DNA molecule is duplicated to make 2…

Q: Describe the three important functions of DnaA protein.

A: The protein that helps in the activation of DNA replication initiation in bacteria is DnaA. It…

Q: Describe how the various operations of DNA replication are coordinated to ensure that a whole genome…

A: DNA replication is the process by a which DNA duplicates itself into two identical copies. DNA…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.