Describe the properties of water that are critical to maintaining life Include a discussion of polarity, temperature stabilization, solvents and cohesion/adhesion
Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle? Serine’s side chain…
A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…
Q: While fatty acids are most often formed by the condensation of --carbon units, Isoprenoids are…
A: Fatty acid is a lipid component found in plants, animals, and microbes. A fatty acid is made up of a…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…
Q: response. 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: RBCs are little red blood cells that transport oxygen from the lungs to the whole of the body's…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Is it somehow possible to generate carbohydrate from non-carbohydrate? If yes, how and if no, why?
A: Carbohydrates are organic molecules, which act as the primary source of energy. Glucose is the…
Q: 5. Protein tyrosine phosphatase-1B (PTP1B) is an important enzyme regulating insulin signaling be-…
A: PTP1B enzyme in question catalyze the hydrolysis of phosphorylated tyrosine on Insulin receptor and…
Q: Explain which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their…
A: Four substances ATP, CoA-AH, FAD and NAD+ are given. Here, we have to identify the subunits in their…
Q: 1) Given the structure of pyruvate below, draw the reaction with NADH to form lactate. (only the…
A: Pyruvate is the end product of the glycolytic pathway. Under aerobic condition, the pyruvate…
Q: What types of monomers make up a carbohydrate? What are carbohydrate polymers called?
A: Carbohydrates are biomolecules made up of carbon, hydrogen, and oxygen. The ratio of H and O is the…
Q: 9. If 32p-labeled inorganic phosphate were introduced to erythrocytes undergoing glycolysis which of…
A: Glycolysis is the process of conversion of one molecule of pyruvate into two molecules of pyruvate.…
Q: Write about the treatment of Complicated and uncomplicated Urinary tract infection? Please answer…
A: A urinary tract infection (UTI) is a frequent form of infection that affects the urinary tract. Any…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: 1-How is a total cholesterol test different from a lipid panel?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: There will be three graphs. They as given below:
Q: 3. How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: What process do all macromolecules have in common?
A: Biological macromolecules are always categorized as organic molecules because they include carbon in…
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot?…
A: Introduction: The study of reaction rates and how they change in response to changes in the…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: The initiation stage in translation starts with the binding of some initiation factors with the…
Q: The vast majority of structures deposited in the Protein Databank (>95%) have been determined using…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…
A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…
Q: A. They carry unneeded cholesterol back to the body's liver, where it is eliminated. 7. Which…
A: Lipids are amphipathic molecules that contain both polar and non-polar parts present in them. Lipids…
Q: Describe the process of DNA replication, including the enzymes involved (85%), and give two examples…
A: DNA replication is a process of duplication of genetic material during the process of cell division…
Q: How do you calculate RNA concentration?
A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…
Q: Which types of ion exchange resin will the the peptide Ala-Glu-lle-Lys- Leu-Asp-Gly bind to at the…
A: Ion exchange chromatography consists of column with loaded resin that can exchange oppositely…
Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…
A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. coenzyme b.…
A: Enzymes are proteins that involved in metabolic function by speeding up the chemical reaction.
Q: (osgnthesis
A: Retrosynthesis is a breaking down of targeting molecule by the process of ''breaking down '' a…
Q: CASE STUDY # 2 A 2-year-old black girl is being seen by the hematologist after her pediatrician…
A: The red blood cells (RBCs) are the most important blood cells. They are in charge of transporting…
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: Consider an enzyme (P) that gets activated by forming a dimer (P2): 2P P2 At 25 °C, we have AH- 19…
A: ∆Ho is change in enthalpy of the protein activation= 19KJ/mol, it is the heat content of the given…
Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…
A: The equation for the oxidation of glucose is:
Q: CH,0-P-O C=o 0. CH;0-P-O CH,OH C=O Ó. HO-C-H H-C-OH H-C-OHO C-H ČH;O-P-O- H-C-OH O CH;0-P-O 0.
A: Glycolysis is the process in which glucose is broken down to produce two molecules of pyruvate, ATP,…
Q: Enzymes occasionally display weak "side" activities. Draw the structure of the product (other than…
A: Pyruvate is formed in the last step of glycolysis with release of one ATP per molecule, catalyzed by…
Q: 8. Which of the following is commonly known as the Complex II of the electron transport system of…
A: Electron transport chain is a series of protein and organic molecules located in the inner membrane…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Determine the amino acids that compose the peptide shown below.
A: Amino acids are compounds with a carboxyl group and amino group attached to the same carbon atom.…
Q: What diseases are the related protein deficiency in the human body? Explain their rationale.
A: Protein deficiency occurs in the human body when the body does not get enough amount of protein that…
Q: Pyruvate is produced in glycolysis and used by Kreb's Cycle in the mitochondrial matrix. How does…
A: Glycolysis is the process by which glucose is converted to pyruvate along with production of…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: A mutation is considered as a change in a DNA sequence. Mutations can easily result from specific…
Q: a) Give an appraisal of prokaryote cell lines as recombinant polypeptide expression systems. (b)…
A: The bacterial expression system is widely used for the recombinant expression of mammalian proteins.…
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: Calculate the free energy change for glucose entry into cells when the extracellular concentration…
A: Free energy change The change in free energy (ΔG) is basically the difference between the heat…
Q: ANSWER BRIEFLY EACH QUESTION 1. Why is confirmatory test important to perform in different drug of…
A: The question talks about different substance abuse compounds. Right after the screening of drugs the…
Q: In the majority of cases, amino acid catabolism can be broken down into a two-step process;…
A: The catabolism of the amino acids begins with the removal of the amino group. The amino group can be…
Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…
A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…
Q: Food Sample marshmallows Pumpkin seeds cracker Dried cranberries рорсorn Rice cake almond
A: Calorific value of foods is based on their nutrient content. Calorific value of foods is the total…
Step by step
Solved in 2 steps
- Describe the special properties of water that make it vital to living systems, including: polarity, cohesion, temperature-stabilizing effects, and solvent properties.Explain the each of the following properties making water important to lifeWhat property of water helps retain heat in the water when air temperature drops? cohesion evaporation density adhesion
- describe the biologically important properties of water;Define the terms acidic, basic, acid, and base. Also define pH and describe the relationship between pH and the H+ concentration of a solution.In the presence of water, nonpolar associations form between molecules or regions of molecules that are ____. A. partially charged B. hydrophobic C. hydrophilic D. hydrophobic and hydrophilic
- Which of the following are properties of water that make itimportant for living cells?(a) It is a polar molecule that can form solutions.(b) It has high surface tension.(c) It has a high specific heat.(d) It can participate in dehydration and hydrolysisreactions.(e) All of the above.compare and contrast the emergent properties of waterWhich of the following is a hydrophobic material?(A) paper (B) table salt(C) wax (D) sugar
- Which of the following is correct about the properties of water? Three of the qualified choices could serve as correct answers to the question It is an amphipathic molecule (Two of the qualified choices could serve as correct answers to the question) Its molecules are cohesive None of the qualified choices could serve as correct answers to the question It is an ambivalent molecule It is an asymmetric polar solvent amino a It demonstrates temperature-stabilizing capacities It is covalently linked with other water molecules by hydrogen bondsDescribe the properties of water, and explain why it is so important in biological systems.Part of the uniqueness of water as a solvent include except