Answered: DNA G CU MRNA T U GOOC ERNA fethionine…

Name: Protein Synthesis Worksheet KeyDNA1.2.G C UMRNA3.TRNAAminoAcids4. (Me
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Protein Synthesis Worksheet KeyDNA1.2.G C UMRNA3.TRNAAminoAcids4. (Methionine5. MRNA is synthesized in translation or transcription?6. MRNA has codons or anti-codons?DNA7.8. CMRNAU A tRNA9.CAminoA cids10.Leucine-0--00--0--0--0--0--0-

Science

Biology

DNA G CU MRNA T U GOOC ERNA fethionine Amino Acids NA is synthesized in translation or transcription? NA has codons or anti-codons?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA. MRNA 5' ------------AUG------------AGG----------GAG
5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
Let’s practice making a strand of mRNA. Finish what we started: DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TmRNA: A-U-GGo ahead and write out the complementary strand of mRNA above
1. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine
A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate sequence could be transcribed instead of the template sequence. Draw the nontemplate sequence in 3’-5’ order (because remember you have to flip it for your brain to read it like RNA Polymerase would J). Then draw the mRNA sequence and translate it using Figure 14.6 (or any codon chart). Predict how well the protein synthesized from the nontemplate strand would function if at all.
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. Ø What is the resulting polypeptide: Ø Would this mutation allow the protein for perform the intended function? Why or why not?
Multiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these PreviousNext
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain: