emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at a ribosome is: a. GUA b. UAG c. UGA d. AUG GC AT e. b and c CUAT 20. Which of the following terms is defined as the process by which water breaks down (splits apart) polymers into

emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at a ribosome is: a. GUA b. UAG c. UGA d. AUG GC AT e. b and c CUAT 20. Which of the following terms is defined as the process by which water breaks down (splits apart) polymers into

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: 18. In the following figure, structure C represents a , while structure F represents a Asparagine D…

A: The figure shows the process of translation.Translation is the process in which ribosomes in the…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: II. Identify what the mRNA, tRNA and amino acid for the DNA bases below. DNA bases below can be…

A: The mRNA and amino acids sequences can be deduced by DNA sequence. The mRNA sequences are…

Q: 5) Answer the following questions about the Ribosome pictured below. a) What is the region of the…

A: Transcription It can be defined as the synthesis of polypeptide chain by using mRNA. The synthesis…

Q: 2 of 22 The direction of synthesis for a new MRNA molecule is from a template strand, and this…

A: Transcription is the process of synthesis of mRNA from a DNA molecule. The process of transcription…

Q: 7. Complete the table below by specifying where each of the indicated entities is found? Specify the…

A: Post-transcriptional modification is a process that follows after the transcription, where the newly…

Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…

A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…

A: Introduction:: The correct choice is option (b).

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: 21.Trace a protein molecule from the mRNA for it leaving the nucleus to its secretion from the cell.…

A: Cytosolic protein lack N terminal signal peptide. Translation completes on free cytosolic ribosomes.…

Q: 25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in…

A: Adenine(A) and guanine(G) are purines ; cytosine(C) and thymine(T)/uracil(U) are pyrimidines , both…

Q: bust me int Tly di gerlarat bu nd ambigu 22. Some tRNAS contain inosine, which can base pair with A.…

A: A transfer RNA or tRNA:It is a special type of RNA molecule. It helps in matching of an amino acid…

Q: 21. Which of the following mutations would be expected to have the most harmful effect on the…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: Introduction: A genetic code is a dictionary that corresponds with the sequence of nucleotides and…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: 5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C.…

A: All these terms are related to DNA, mRNA and tRNA. DNA stands for deoxyribonucleic acid. RNA stands…

Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…

A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…

Q: 7. The beoads on a string in the picture represent what in terms OE DRA 20lding? "Beads on a string"…

A: Template strand is also known as sense strand. This is actively involved in transcription. The…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Select ALL of the following that apply to translation. Select one or more: a. occurs in the nucleus…

A: The translation is a process that is part of the central dogma that follows the process of…

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: 7. Look at 6a and 6b. Compare the RNA sequences and the polypeptide sequences they code for. What…

A: A base pair is two nucleotides that together constitute a DNA ladder." A DNA nucleotide is composed…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes…

A: The mRNA at the third position is AUG and it is called Initiation codon.

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Many protein modifications take place in the endoplasmic reticulum (ER). Name one ER enzyme (and…

A: Note- frame the question correctly and repost it. Thank you!!

Q: Which of the following is a true statement concerning condons

A: Codons are nucleotide triplets that are read together in order to specify amino acids during…

Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be…

A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are…

Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…

A: The information for the production of functional proteins are stored in segments of DNA called…

Q: 5'.GTCATCTTGACATTG... 3' The same strand now has a single base insertion of an A, indicated in blue.…

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…

Q: cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A…

A: The ribonucleic acid consists of a single stranded structure which consists of a ribose sugar. It…

Q: 10. During elongation of a peptide chain, which site in the ribosome represents the location where…

A: Translation is the process of the formation of polypeptide chains of amino acids that lead to the…

Q: 11. Consider the sequence shown, determine the complementary RNA and the amino acids DNA TAC GTA TTT…

A: In this question, we are given sequence of DNA from which we have to determine RNA and protein…

Q: 25. An RNA chain being synthesized grows in the direction. a. 5' to 3' Ob. 3' to 5' c. either…

A: Transcription is the process in which a gene's DNA sequence is copied to make an RNA molecule. The…

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Q: Compare the structure and functions of DNA nad RNA.

A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: 2. Which one of the following statements is TRUE of bacterial transcription? A. It produces pre-mRNA…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: (2017 6C) A model of a biological process is shown. MRNA 13' AGCUGACCUAG CG GACAA || GAU CG C A Asp…

A: The process of protein synthesis is a dynamic process, which involves 3 essential components namely…

Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…

A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…

Q: 40.The mRNA codon for methionine is the start codon in eukarvotes. What is the corresponding three…

A: The start codon is the sequence of three nucleotides present on mRNA that is responsible for the…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: The role of mRNA in protein synthesis is that it ____.

A: Proteins synthesis is the most important essential and significant metabolic activity of the living…

Question

emist
19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at a ribosome is:
a. GUA
b. UAG
c. UGA
d. AUG
GC AT
e. b and c
CUAT
20. Which of the following terms is defined as the process by which water breaks down (splits apart) polymers into

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Please answer fast Give ans for each statement 1.A protein linked to a disease state is being studied by scientists. They discover that the disease protein has the same amino acid sequence as the protein in healthy people. State right or wrong: Does the following explanation provide a plausible biological explanation for the disease state? a.The RNA polymerase does not correctly read the codon code on the mRNA. b.The protein is not being regulated properly. c.The disease protein is incorrectly folded. d. The disease protein lacks a post-translational modification. e.The protein amounts differ because they are expressed differently.
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: Use the following base sequence of one strand of an imaginary DNA molecule: AATTGAACACATGCGCCC. 2. Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step…
Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing polypeptide strand the ribosome the messenger molecule that provides the code for protein synthesis the intron
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
31. AN ENZYME WHICH IS A LOW MOLECULAR WEIGHT AND DIALYZABLE? A. APOENZYME B. HOLOENZYME C. PROENZYME D. COENZYME 32. USING THE GENETIC CODE, WHICH OF THE FOLLOWING IS NOT A TERMINATION CODON? A. UGA B. AUG C. UAA D. UAG 33. WHAT IS THE INITIATION CODON ON THE GENETIC CODE? A. UAA B. AUG C. UAG D. UGA 34. HOW MANY AMINO ACIDS ARE THERE IN THE PEPTIDE SEQUENCE CORRESPONDING TO AGGGCAUGCACCCGAGCUAAUGG? A. 8 B. 4 C. 10 D. 14 35. CONSIDERED THE BUILDING BLOCKS OF NUCLEIC ACID? A. SACCHARIDES B. NUCLEOTIDES C. AMINO ACIDS D. FATTY ACID
Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: CGATACAAA
Translation requires energy what step(s)? please explain answer B) 30S ribosome subunit binding C) peptide chain elongation A) amino acid attachment to tRNAs both A and B both A and C
DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
Polysomes and Rapid _______ Recycling Increase the Efficiency of Translation.
Let’s practice making a strand of mRNA. Finish what we started: DNA: T-A-C-T-T-A-C-A-C-G-T-C-A-A-C-G-T-G-C-C-T-T-A-G-C-C-A-T-TmRNA: A-U-GGo ahead and write out the complementary strand of mRNA above
Hi, how to Circle or identify the codons on the mRNA sequence.
DNAT A C C A C C C C C G T A T G G C T G G G A A T A T C mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______