
Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Examine the following sequence of DNA
3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG – ACT – AGG-5’
Write out the complementary DNA sequence (identify 3’ and 5’ ends)
Write out the complementary mRNA sequence
Write out the peptide sequence this DNA encodes
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 4 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)arrow_forwardWhy would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat O DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariatarrow_forwardGive only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'arrow_forward
- AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acidsarrow_forwardDNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5' MRNA: Any possible protein?arrow_forwardWhat strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC (assume transcription is from left to right)? Indicate clearly the 5' and 3' ends of your transcript. 5'-GAUGUUUAC-3' 5'CUACAAAUG-3' 5'-CAUUUGUAG-3' 5'GUAAACAUC-3arrow_forward
- The first nucleotide in mRNA that will be synthesized from DNA below is: 3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'arrow_forwardIf the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be: 5’AUGGCAU 3' ОЗ ТАССGTA 5' 3' UACGGUA 5' 5' ATGGCAT 3' O 5' UACGGUA 3'arrow_forwardThe complement to a coding strand has the sequence 5' - TACTTTAGGATC - 3'. What is the MRNA strand for this sequence?arrow_forward
- Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the following polypeptide. The signal “!” means a stop codon:MYCATEATMYRING!arrow_forwardGiven the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON

Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman

Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY

Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON