Question

Explain which type of inheritance involves an affected female mating with an unaffected male resulting in all affected sons and no affected daughters. Include a sample pedigree AND a sample Punnett Square in your explanation.

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Genetics

Related Biology Q&A

Find answers to questions asked by students like you.

Q: The portion of the diencephalon producing a "diurnal hormone" is the  a.epithalamus b.thalamus  c. h...

A: The correct option is a) epithalamus.

Q: Where do the great vessels connect to the heart?

A:  There are five great vessels that enter and exit from the heart, namely, the superior vena cava, in...

Q: You are trying to determine the base content for a number of samples in the lab (mouse DNA, bacteria...

A: A nitrogenous base is an organic compound that has properties of a base and a nitrogen atom. It is i...

Q: Thin and thick filament are organized into functional unit called

A: The skeletal muscles are formed by the skeletal muscle tissues. These tissues have a striated appear...

Q: A karyotype shows that a child has Klinefelter syndrome (47,XXY). If the child is also colorblind (d...

A: Karyotyping is the process of taking photographs of chromosomal pairs to determine the number of chr...

Q: The idea that the study of the human body can be most thoroughly understood through the principles o...

A: The study of the structures of the parts of the body is termed as the anatomy, while the study of fu...

Q: 12) Draw a yeast knockout cassette. Label all required sequence features.  a) Draw the target chromo...

A: Hi! As you have posted multiple questions and asked to provide with two knockout diagrams, we are pr...

Q: Until very recently, the fitness of an individual getting familial retinoblastoma was zero, and if t...

A: Fitness is the propensity of an individual to reproduce and contribute its genes to the progeny. A f...

Q: If I have a strand of DNA that has the base pairs as below, what would the base pairs be on the comp...

A: Adenine complements with thymine and cytosine complements with guanine in a DNA strand. According to...

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, id...

A: The central dogma involves two processes to bring about gene expression, namely transcription, and t...

Q: Can you please answer 38, 39, and 40

A: We are authorized to answer one question at a time, since you have mentioned three questions, so we ...

Q: PLEASE HELPPP

A: All animal genomes, including those of sponges that are the most primitive animals, carry Hox genes....

Q: What are the advantages and disadvantages of tail docking in horses? please list several reasons and...

A: Docking is defined as an intentional removal of part of the tail of an animal. It is done for practi...

Q: What is the most common element in the human body?

A: There are various elements that form the human body. The elements are important to regulate the cell...

Q: What is the difference between a bio lab question asking me to describe the chemical composition of ...

A: Raw banana undergoes a series of biochemical reactions, which includes softening of the mass by degr...

Q: 7 Cinnabar eyes is a X-linked recessive characteristic in fruit flies. If a female having cinnabar e...

A: Cinnabar eye is an X-linked recessive characteristic in fruit flies. Usually, X-linked recessive tra...

Q: 2. Imagine you have mixed the following known concentrations of a solution. You then measured their ...

A: A standard curve or a calibration curve is a graph plotted against absorbance of known concentration...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: T4 - For the hormone T4 (in humans) what is; 1. the origin (gland that secretes the hormone) 2. acti...

A: 1.   The Origin of T4 hormone- It is secreted by the thyroid gland. Thyroid gland is a bilobed endoc...

Q: what are the major features of the nine major phyla?

A: Phylum represents a taxonomic level for the classification of biological organisms. Animal phylum is...

Q: What are the four different point mutations? How can genetic mutation (genotype) alter protein struc...

A: Point mutations are chromosome rearrangements. They are usually the consequence of errors made durin...

Q: explain the role of glutamine system in adjusting the blood PH

A: Glutamine is an amino acid which is used in protein synthesis. Glutamine plays an important role in ...

Q: Can you please answer question 1,2, and 3 please

A: Answer for question 1In an adult human body, the cell that does not undergo mitosis is a neuron.  Th...

Q: 020-2 b My Qu X All Cha Nazare Permis h BIO210 Co X Master Anator Chapte um.ecollege.com/course.html...

A: Connective tissue is a group of tissues present in the body that maintains the form of the body and ...

Q: 16) What are THREE pieces of evidence that support the theory of endosymbiosis?

A: The endosymbiotic theory of evolution states that some organelles of eukaryotes, such as chloroplast...

Q: Why are anatomy and physiology studied together?

A: Anatomy, histology, physiology, and embryology are the branch of science that deals with the human b...

Q: What is the human genome project and what were its goals and two big surprises?

A: Mapping and sequencing the human genome will result in new information and materials of potential co...

Q: Draw the phases of mitosis for a cell with a chromosome number of 4. Please answer also number 9-11....

A: Click to see the answer

Q: Please explain: Transcription-what is it and what does it involve? What happens at initiation, elong...

A: Transcription is the process by which DNA is copied or transcribed to mRNA, which carries the inform...

Q: Estrogen - For the hormone  Estrogen (in humans) what is; 1. the origin (gland that secretes the hor...

A: Endocrine glands are made up of specialized cells that make hormones. Hormones function as chemical ...

Q: 11) Draw a bacterial expression vector with all required vector sequences. Be sure to label any spec...

A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to ...

Q: how does aldosterone affect water and sodium reabsorption and secretion of potassium in the collecti...

A: Aldosterone is a steroid hormone that is produced in the cortex region of the adrenal gland. Its mai...

Q: What is the difference between anabolism and catabolism?

A: Anabolism and catabolism are the two important sets of reactions of metabolic processes. Anabolism r...

Q: List and briefly describe the function of 4 proteins used in DNA replication in a E. coli but NOT ne...

A: The process of copying a DNA molecule to produce its two identical copies is termed as the DNA repli...

Q: Explain how gel electrophoresis works?

A: Gel electrophoresis is a method used to separate macromolecules like DNA, RNA, and proteins. The pur...

Q: Identify the three true statements about the structure of keratin.

A: The proteins play a crucial role in the body as they are present in hair, skin, bone, and almost all...

Q: Can you please label the rib cage

A: The ribs:These are the bones that partially surround and protect the chest cavity along with other m...

Q: What is the "genetic code" and what aspect of post translational modification virtually mandates tha...

A: Genetic code is a set of rules followed by every living cell by which information stored in genetic ...

Q: Illustrate and describe the growth curve stages a bacterial culture experiences in a closed system.

A: Click to see the answer

Q: Why are fats well suited for energy storage in human body?

A: Carbohydrates, fats, and proteins are the three essential macronutrients and are required by the bod...

Q: Summarize the aspects of Neanderthal behavior and culture that strongly counter the assumption that ...

A: Several explanations have been put forward to justify the hypothesis regarding Neanderthal's inferio...

Q: Can you please label the skull

A: A skull is a bony structure that is composed of cranium and facial bones. The composition and the sh...

Q: What items lead to genetic variability in the offspring during meoisis and identify stages when that...

A: Cell division is a biological process that results in the production of two or more daughter cells f...

Q: Microbiology-Discuss the various ways by which antibodies interact with antigen and facilitate antig...

A: The different types of interactions that mediate the destruction or inhibition of antigen are as fol...

Q: Describe the observations and inferences that led Charles Darwin to his theory of evolution by natur...

A: Charles Darwin gave the theory of evolution through natural selection. According to this theory, org...

Q: 17) There is a hypothetical gene in mice that produces a substance that induces twitchiness in leg m...

A: Twitching of muscles means muscle fiber contraction in response to a stimulus by the nervous system....

Q: Reverse Firing of neurons allows for ? 1.  Myelin Sheath to grow2. Hard wiring of neural networks3. ...

A: Electrical signals which convey information, travel from dendrites through the cell body to the leng...

Q: Parathyroid Hormone - For the hormone . Parathyroid Hormone (in humans) what is; 1. the origin (glan...

A: Click to see the answer

Q: How does Mendel's Laws relate to Meiosis? Examples?

A: The passing of traits from one generation to another follows the laws given by Gregor Mendel, the fa...