Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Related questions
Concept explainers
Question
The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.
a. Start codon
Transcribed Image Text:FMet pro
UAC
GGG
AUGCCCACG
UAG
MRNA
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The figure below shows the stage in translation when an incoming aminoacyl-tRNA has bound to the A site on the ribosome. Using the components shown in Figure part A as a guide, explain in detail what happens in the next two stages to complete the addition of a new amino acid to the growing polypeptide chain. Use the E, P, and A sites in your explanation as well as the small and large ribosomal subunits. (A) STEP 1 H2N- E 5' 13' (B) STEP 2 E P A 13' (C) STEP 3arrow_forwardHow can you identify the start codon in the mRNA sequence ?arrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Place on the ribosome where release factor 1 will bindarrow_forward
- A segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap pleasearrow_forwardExplain the three steps (Codon recognition, peptide bond formation, translocation) in elongation step of translation.arrow_forward28)arrow_forward
- The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. A, P, and E sitesarrow_forwardSelect all of the factors in the list below that play a role in the translation initiation of eukaryotic cells. the Kozak sequence eIF4G 3'-polyA tail fMet-tRNA the Shine-Dalgarno sequence eIF4E 5'-CAP PolyA Binding Protein (PABP)arrow_forwardAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)arrow_forward
- Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? A - during initiationB - during elongationC = during terminationD = during protein releasearrow_forwardWhat are the two functional ends of transfer RNA and how do they work to accomplish these functions? Draw a simple figure illustrating the molecule and label these “ends.”arrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. Stop codonarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education, 
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education