Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the nucleotide sequence of the DNA strand complemantary to sequence given above B Give the sequence of nucleotide in the Mrna that would be synthesized if the complementary strand in the answer above is used as a template during transcription

Q: In problem 2e, how can you identify added mutations?

A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template.…

A: Transcription is the process in which a DNA strand gets transcribes into RNA by the help of RNA…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: . You are provided with the DNA sequence in the leading strand template. See item number 1 in…

A: DNA is a molecule that carries the genetic information for the individual.

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: The central dogma of life involves DNA replication, transcription, and translation into proteins.…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule…

A: Thank you for the question  Answer The Genes code for proteins. These proteins are the workhorse of…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: The diagram below shows a section of double-stranded DNA undergoing both transcription and…

A: DNA replication is the process in which the DNA copies are made by the action of several enzymes…

Q: Translate this DNA sequence using Genetic Code 5' - ATG GGG cCC GTC CAT CCG TAC GCC GGA ATT ATA - 3'…

A: DNA is transcribed into mRNA through the process of transcription. mRNA is then translated into…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a…

A: The DNA is transcript into mRNA by the process of RNA transcription with the help of RNA polymerase…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: 5’      UUGCAUUGCAGC    3’    Write out ALL of the possible reading frames for the RNA shown in…

A: The DNA acts as the genetic material of a living organism. This DNA generally gets replicates to…

Q: RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of…

A: During the process of transcription. RNA polymerase is the enzyme and its main function is to…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

A:

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: The process of formation of mRNA from DNA is called transcription.

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…

A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…

Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…

A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: Transcription is the process where mRNA will from form DNA, then mRNA will from protein in…

Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…

A: Within the biological system, the flow of genetic information is explained as molecular biology's…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: Match Column A with Column B.…

A: transports amino acids to the site of protein synthesis- tRNA- tRNA is responsible for the transfer…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: The following represents a transcription unit in a hypothetical DNA molecule in E.coli.…

A: DNA ( Deoxyribonucleic acid ) is a double stranded molecule whereas RNA is single stranded.…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…

A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…

Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: During DNA replication a mutation occurs that reuskt in the following chnage in the corresponding…

A: It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…

A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…

Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…

A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…

Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…

Q: Do you think it matters which protein is mutated? Is one protein more important than another?  How…

A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription  Formation of RNA over DNA template is called transcription.  Translation The process…

Q: What role does methylation play in mismatch repair?

A: Introduction  DNA replication is a very speedy process where around 400 nucleotides are added per…

Q: Original DNA ЗТАС ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that act as genetic…

Q: You are provided with the DNA sequence in the leading strand emplate. See item number 1 in…

A: Central dogma- DNA duplicate into DNA via replication , DNA convert into RNA via the process know as…

Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…

A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.