H2C „CH

Q: Assuming that the pH of the IMS is 1.4 units lower than the pH of the matrix, the free energy yield ...

A: The H+/ATP ratio, defined as the number of protons necessary to synthesize one ATP at equilibrium, i...

Q: if the 3 to 1 transition has an energy of 1.94x10^-18 J what do you think the energy of the 1 to 3 t...

A:

Q: The polarity of DNA synthesis is A. 5' 3'. O B. 3' 5'. O C. 5' 2'. OD. 2- 5'. E. None of the choices...

A: Answer - option A -   5'-->3'     DNA replication is semiconservative. Each strand in the double ...

Q: n the preparation of the standard curve for protein analysis, 50 mn BSA (bovine serum albumin) disso...

A: Given – Weight of BSA = 50 mg The final stock solution = 5 ml To calculate – Weight of BSA in 0.1 ml...

Q: Two phenotypically normal parents produce an abnormal son in which chromosome 14 is missing part of ...

A: Translocations are chromosomal rearrangements caused by the exchange of components between two nonho...

Q: 7. As shown below glycerol and two fatty acid molecules formed diglyceride by но, .CH3 Ô CH3 O two g...

A: Chemical bonds are the attractions between two chemical species. There are different types of bonds....

Q: Dottle of salad dressin g that contain s oil and vinegar has f wo lavers

A: Polar Molecules are molecules that contain positive and negative charges. Charged molecules also con...

Q: Fasting decreases serum leptin levels True O False

A: It is seen that fasting reduced serum leptin concentrations by 60-70% within 52 hours in normal-weig...

Q: Why is knowing the protein sequence important?

A: All proteins in all three classes of organisms i.e bacterial, archaeal, and eukaryotic—are construct...

Q: they said that oxygen radicals are reactive, and unsaturated fatty acids are reactive too. does it m...

A: Unsaturated fats are more reactive due to the presence of the multiple bonds between carbon atoms. T...

Q: A 22-year-old woman presented with a 2-week history of progressive severe headache and blurry vision...

A:   Answer - A. Vitamin A acute and chronic types of hypervitaminosis A cause headaches and blurry vis...

Q: What is the minimum amount of Glutamic acid in the system to initiate the action potential?

A: Glutamate or glutamic acid is a relative of gamma-aminobutyric acid (GABA), which binds to ionotropi...

Q: A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose ...

A: Proteins are formed of peptide bonds formed between the amine group and the carboxyl group of the am...

Q: For each 2 carbons present in a fatty acid before beta oxidation how many acetyl-CoA molecules are p...

A: Beta oxidation is a process for cell for yielding metabolic energy. Each round of beta oxidation yie...

Q: Dicuss the biological advantages of Pseudoephedrine to an actively competing athlete

A: Pseudoephedrine is a drug that is similar to the drugs belonging to amphetamine and phenethylamine c...

Q: Glutamic acid, Leucine, Arginine What is the ionization state at pH 10?

A: The pKa value of amino acid refers to the state of equilibrium between the deprotonated nitrogen and...

Q: Proteins have complex three-dimensional structures. These polymers are held into these specific shap...

A: Biomolecules are the biological molecules that are present inside the living organisms. These molecu...

Q: ______ is an organized structure formed when phospholipids are mixed with water

A: Phospholipids consist of a hydrophilic head that contains phosphate group and hydrophobic tail which...

Q: 1. Why ninhydrin is used in paper chromatography?   2. How do you identify amino acids on the chro...

A: Chromatography is method of physical separation of the compound. Chromatography is based on the part...

Q: QUESTION 5 Observe this replication fork. The lagging strand is the O Top O Bottom Click Save and Su...

A: Answer - BOTTOM. 

Q: Identify the chiral carbon in each of the following compounds: a. citronellol; one enantiomer has t...

A: Organic compounds are often composed of carbon, hydrogen, oxygen, and nitrogen. The structural backb...

Q: please help me understand asap Please draw by hand a tripeptide of Glu, Gln, and 1 amino acid of you...

A: A tripeptide is a peptide that was derived from amino acids joined by a peptide bond. where a carbox...

Q: Φ and ψ in the Ramachandran plot (below) are: a) Rotational angles around the bond between the α-ca...

A: Answer- option a -Rotational angles around the bond between the a-carbon and N-H (Φ) and C=O (Ψ) . 

Q: A total of 30.5 kJ mol-1 of free energy is needed to synthesise ATP from ADP and Pi  when the reacta...

A: Food is a substance that consists of various nutrients such as carbohydrates, fats, proteins, vitami...

Q: +2, and 4.03. the following 0.10 M solutions available: CH3COOH, NACH:C00, NHẠCI, NH3, NAHCO:, and N...

A:

Q: 66. Which of the following statements about endocrine hormones is always true? A. They are secreted ...

A: Hormones are chemical compounds that alter the functioning of another part of the body(target site)....

Q: 9. Which of the following is a compound lipid?|

A: Compound lipids are esters of fatty acids which consist of fatty acid, alcohol, and additional group...

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that ...

A: Non-coding DNA sequences are DNA sequences that do not encode protein sequences in an organism. Nonc...

Q: Both alpha-helices and beta-sheets (select any/all answers that apply):    A. are examples of seco...

A: Proteins are made up of several amino acids. They are present in large quantities as compared to oth...

Q: 4. Stored lipids "fat depot" is stored in the human cells acts as O a store of energy. a pad for the...

A: Nutrients are classified into micronutrients and macronutrients based on the amount of requirement. ...

Q: On blood agar whattype of hemolysis. wouldmicrococcuscoseus.have? aBor of it a

A: Micrococcus roseus shows Gamma hemolysis on bloodcagar

Q: What are the important steps in the isolation of pectin from citrus peel?Why each steps are importan...

A:

Q: Identify different types of organic reaction mechanism (SN1, SN2, etc.) and reaction types (Addition...

A: Hi! Thank you for posting the question on Bartleby. As per the guidelines we can answer only three s...

Q: What does it mean when a person is lactose intolerant? Biologically, what causes this? How can it te...

A: Lactose intolerance is when our body can't break down or digest lactose. Lactose is a sugar found in...

Q: 1) Lysine is one of the 20 amino acids that found in protein. Draw the form (s) of lysine that would...

A: We are authorized to answer one question at a time since you have not mentioned which question you a...

Q: All of the following essential oils are suitable for chronic pain except: Choose one answer. a. grap...

A: Answer - Lemongrass oil.   

Q: Topic: laboratory Instrument Which of the following is/are TRUE Which of the following is/are TRUE r...

A: Microscope are the instrument used to view enlarged image of a minute structures at a scale convenie...

Q: Why would cooking a plant or piece of meat affect the activity of catalase, but not the activity of ...

A: Enzymes are a class of proteins that act as biological catalysts. They increase the rate of the reac...

Q: 4. Where do lines intersect on a Lineweaver-Burk plot showing competitive inhibkion Uncompetitive in...

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...

Q: 1.What is the optimum temperature for invertase reactions? 2.What is the optimum ph for the invertas...

A: Q1. Optimum temperature for invertase reaction is 60°C. Q2 . Optimum pH for invertase reaction is 4....

Q: it into a glass tube filled with 40 ml of water (final volume). What is the amount of dye present in...

A: Stock solution is made in smaller quantity but with higher concentration for storage and stability p...

Q: What is the importance of glycoprotein? Explain briefly.

A: When carbohydrate covalently linked with non-carbohydrate molecule is called as the glycoconjugate. ...

Q: A molecular biologist is investigating homologous recombination. One aim of this study is to reconst...

A: Holliday junction is a four-strand DNA nucleotide strand that is formed during genetic recombination...

Q: Write the condensed structure of the following:

A:

Q: a cutlure starts with 10 cells and is allowed to grow for five generations with no cell death. how m...

A: All living beings are made up of cells, which are the most fundamental and important units. A cell i...

Q: ionic / covalent / hydrogen / electro ionic or none

A: The biological bonds or interactions present in living systems are of two types: Covalent and non-co...

Q: Which level(s) of protein structure result(s) from non-covalent interactions involving both backbone...

A: Ans - Except the primary structure which involves the peptide bonding between two   amino acids, whi...

Q: Which of the following is/are TRUE regarding microscopes? * Brightfield microscopes, a compound micr...

A: Microscopes are devices used to magnify substances that are very small (micro length) to visible. It...

Q: There are a total of six different amino acid sequences for a tripeptide containing one molecule eac...

A: Any peptide that is obtained by a set of three amino acids joined together is known as a tripeptide....

Q: Why is B-D-Glucopyranose in a chair conformation form is the most stable form of glucose present in ...

A: B-D-Glucopyranose is a form of D-glucose which is a hexose monosaccharide unit that consists of six ...