he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′

he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Related questions

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: 5'- -3'

A: The mechanism by which a double-stranded DNA molecule is replicated to create two equivalent DNA…

Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: ou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What mechanism was originally proposed as one of the three models for DNA replication? What is the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: A part of a sequenced chromosome has the sequence (on one…

A: DNA is the genetic element in all cell types of prokaryotic and eukaryotic. DNA is double stranded…

Q: What is The molecular mechanisms governing the initia-tion of DNA replication.

A: Initiation of DNA replication involves making the target DNA accessible to the enzymes and proteins…

Q: The reaction in DNA replication catalyzed by DNA ligase isa) Addition of new nucleotides to the…

A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…

Q: DNA replication reaults in two daughter double hellces, each containing one atrand from the original…

A: DNA replication The production of new double stranded DNA from old one is known as DNA replication.…

Q: Which of the three Mut proteins isresponsible for ensuring that the mismatched basein the newly made…

A: Mismatch repair or MMR is the system that recognizes and repairs any misincorporated, deleted, and…

Q: Why does replication process struggle with repetitive sequence - and how does this impact a certain…

A: Genomes containing lots of repetitive sequences like the human genome create difficulties with…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However,…

A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…

Q: With regard to DNA replication, define the term bidirectional replication.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…

A: The process of DNA replication is essential during the cell division cycle in both the eukaryotic as…

Q: Draw the structure of the double Holliday junctionthat would result from strand invasion by both…

A: Holiday junction are intermediates of homologous recombination and this junction formation occur…

Q: When DNA is replicated, two new DNA double helices areformed, each consisting of one parental strand…

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a…

A: DNA polymerase is defined as the family of enzymes responsible for catalyzing the synthesis of new…

Q: What difference would it make to bidirectional DNA replication if both modes of chain extension were…

A: A nucleic acid is a nucleotide-based linear polymer that functions as part of the cell's information…

Q: A bacterium synthesizes DNA at each replication fork at a rate of 1000 nucleotides per second. If…

A: Nucleotide is a molecule that consists of nucleoside and phosphate group. These are the building…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat…

A: WT replication without slippage:

Q: During DNA replication, what is the very first process to occur? a. synthesis of the lagging…

A: DNA is the genetic material of the cell. It stores and transfers genetic information across…

Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb.…

A: DNA replication is the process of producing two similar replicas of DNA from one original DNA.

Q: During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA.…

A: The process of making copies of the DNA during cell division is called DNA replication. The genetic…

Q: A bacterium synthesizes DNA at each replication fork at a rate of 1500 nucleotides per second. If…

A: The DNA replication is the process by which new DNA is produced from old DNA and it is usually…

Q: How does the synthesis of a daughter DNA strand growing toward a replication fork differ from the…

A: DNA replication is considered a biological process during cell division, where DNA can make a copy…

Q: Kornberg showed that nucleotides are added to the 3' end of eachgrowing DNA strand. In what way does…

A: It is majorly present within the nucleus. DNA can exist in different levels of complexity. Primary…

Q: Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency.…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: To which end (5′ or 3′) of a newly synthesized strand of DNAdoes DNA polymerase add a nucleotide?

A: DNA (Deoxyribonucleic acid) replication is the coping of the double-stranded DNA to produce 2…

Q: What is o The DNA running both ways from one origin of replication to the endpoints, where it merges…

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a…

A: DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Q: In eukaryotes, the Replication factor C (RFC) is a clamp loader. In the absence of RFC, what would…

A: The Replication factor C (RFC) is the accessory proteins that's is essential for the processive DNA…

Q: Why are primers required in DNA replication but not in transcription

A: DNA replication is a process that takes place inside the nucleus of the cell. During replication the…

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms (except few viruses) that…

Q: During DNA replication, the function of RNA primers is to O serve as a binding site for DNA ligase…

A: Introduction : Primer is a short sequence that is synthesised by primase (a type of RNA polymerase)…

Q: the tus ter complex can arrest the replication fork in one direction only. why is it necessary or…

A: Arrest of DNA replication is trigerred by the encounter of a replisome with a tus protein ter…

Q: DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic…

A: Replication is a process in which the DNA gets doubled inside the cell prior to cell division. In…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

he bases of one of the strands of DNA in a region
where DNA replication begins are shown at the end
of this problem. What is the sequence of the primer
that is synthesized complementary to the bases in
bold? (Indicate the 5′ and 3′ ends of the sequence.)
5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Explanation

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?
What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.
In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the extraction method produced short fragments of DNA. Whatsort of results might have been obtained with longer piecesof DNA?
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.
DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
Why are primers required in DNA replication but not in transcription?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?