Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the sequence of the other DNA strand? b. Is it possible to determine if this sequence is from the template strand or from the coding strand? Why or why not?

Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the sequence of the other DNA strand? b. Is it possible to determine if this sequence is from the template strand or from the coding strand? Why or why not?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 22QP: Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3...

See similar textbooks

Related questions

Q: Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: The following sequence of nucleotides is found in a single-stranded DNA…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…

A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do…

A: Replication of DNA is catalyzed by a DNA polymerase enzyme. There are many types of DNA polymerases…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In…

A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…

Q: During DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA…

A: Option c

Q: If a piece of the template strand of DNA has the sequence 5’- ACG.ACC.GCC.GGT -3’ and it is…

A: Codon is a group of three bases in mRNA. Each codon specifies an amino acid.

Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…

A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA. DNA…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…

Q: Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the…

A: DNA polymerases are enzymes that synthesize DNA molecules from deoxyribonucleotides (the building…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that…

A: Introduction: DNA is a hereditary material that transfers from one generation to another. It is a…

Q: Is it unusual that the β-subunits of DNA polymerase III that form a sliding clamp along the DNA do…

A: DNA pol II is the primary enzyme involved in DNA replication. It is a mutiprotein complex that…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A: DNA polymerase moves along the template strand in a 3'–5' direction, and the daughter strand is…

Q: You have determined that the newly synthesized strand of DNA in your sequencing reaction has the…

A: Template Strand will be: 3' TGATGGCTCA5'

Q: The enzymes DNA polymerase in E.coli is a DNA dependent polymerace and also has the ability to…

A: DNA replication is the semiconservative process. The DNA polymerase is the main replicative enzymes…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: DNA double helix is stabilized by ... a) H-bonds between the sugar-phosphate backbones. b)…

A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…

Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…

A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…

A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T), Guanine (G), and…

Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…

A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…

Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .

A: DNA is a double helical molecule, in which two complementary strands are held together with the help…

Q: Question mentioned in the attachment

A: B form of DNA is considered a right-handed double helix DNA. It tends to runs in opposite directions…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel electrophoresis:- it is a technique through which DNA, RNA, or protein can be separated. When we…

Q: DNA polymerases cannot initiate DNA synthesis without a primer, a section of nucleic acid having a…

A: Primase is an RNA polymerase which produce short strand of primer required by DNA polymerase in DNA…

Q: BamHI recognizes 6 base pairs of DNA in a palindromic DNA sequence. If the first part of the…

A: Introduction BamH1 is a restriction enzyme that cleaves the DNA sequences at specific sites and it…

Q: Which of the following subunits of DNA polymerase has proofreading ability?

A: Introduction: The hereditary material which transfers from parents to offspring is DNA. It is stored…

Q: Which of the following pairs of base sequences could form ashort stretch of a normal double helix of…

A: Deoxyribonucleic acid (DNA) is the hereditary material present in humans and almost all organisms.…

Q: The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands…

A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…

Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…

A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…

Q: a) What is the sequence of the copy and the template strands? b) If the template strand were in the…

A: A DNA primer complementary to the template DNA (the DNA to be sequenced) is used as a starting point…

Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…

A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…

Q: If dhe sequence and directionality of one strand of DNA 1s 5-GCTAG-3', what is the sequence and…

A: DNA stands for deoxyribonucleic acid is composed of two polyneuclotide chains that could around each…

Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…

A: DNA, deoxyribonucleic acid is a molecule which stores the genetic information of an organism and…

Q: The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of…

A: DNA sequencing is the technique of determining the sequence of individual nucleotides in a gene or…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of formation of mRNA transcript. It can be divided into three stages:…

Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…

A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…

Q: Given the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would…

A: Introduction Deoxyribonucleic acid, or DNA, is a molecule that holds the instructions that allow an…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel-electrophoresis:- it is used to separate the fragments of DNA, RNA, as well as proteins on the…

Q: In the sequences below, which is the coding strand and which is the template strand? A. 5-…

A: The strand of DNA which serves as the template for the mRNA synthesis during transcription is called…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Electrophoresis separates the DNA strands based on their size. Thus, the smaller fragments sieve…

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

Please help me answer part b. of question 2.7.

Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3'
a. What is the sequence of the other DNA strand?
b. Is it possible to determine if this sequence is from the template strand or from the
coding strand? Why or why not?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 19

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
You have determined that the newly synthesized strand of DNA in your sequencing reaction has the sequence 5�-ACTACCGAGT-3�. What is the sequence of the template strand?
Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.
If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA that is transcribed from this gene is: 5'AUGUAUGGUUGACUCCUAGCG3' Which strand of the DNA - top or bottom - is the template strand? Explain how you know.
If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the complementary DNA strand?
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Which of the following DNA strands (oligonucleotides) would have a higher melting temperature? (Note: only one strand is shown, but assume that each is double stranded) Select one: a. They would all have about the same melting temperature. b. ATGATCTACTATGAT c. ATGCGTCGCGCAGCT d. ATGATCGATATGCCA e. ATGCGATCAGCTACG
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?