Answered: How are the two strands of double…

How are the two strands of double stranded DNA held together O Covalent bonds between phosphate groups O Hydrogen bonding between bases O van der Waal interactions Duct tape

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 22QP: Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3...

See similar textbooks

Related questions

Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: If I'm any organism a dna molecule is 24% cytosine, how much adenine will that dna molocule contia

A: The rules of Chargaff are significant because they refer to a kind of "biological grammar," or a…

Q: The two strands of DNA are O antiparallel. O parallel. O even. O share the same ends.

A: DNA is made up of two strands and both strands are anti parallel to each other.

Q: What is different between RNA and DNA? a. Only rna has adenine b. Only dna forms hydrogen bonds…

A: Deoxyribonucleic acid, also generally known as DNA, is defined as a complex molecule that contains…

Q: Unzipped Single Strand of DNA Complementary Strand of DNA Build the complementary strand of DNA to…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…

Q: When DNA copies itself..the first step that DNA must do is: O DNA Polymerase checks for errors after…

A: The synthesis of new DNA molecule from the old DNA is known as the replication process. The…

Q: Which of the following about the DNA synthesis reaction is false? O Phosphodiester bond formation…

A: DNA replication is the process by which DNA duplicates itself using DNA as a template and DNA…

Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT

A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…

Q: : does it mean that one end of a DNA strand is the 3' ene here is a phosphate attached to the base.…

A: DNA molecule has a certain polarity that is its two strands are considered antiparallel which means…

Q: What forms the chemical code within a molecule of DNA? O The arrangement of the sugars and bases O…

A: Option C is correct.

Q: What type of bonds does DNA ligase create between adjacent nucleotides? O a peptide O…

A: DNA replication refers to the sunthesis of DNA from the parental DNA. It takes place in the nucleus.…

Q: ider the structure and function of DNA. Which of the following statements is TRUE? O Because DNA…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: If the sequence of one strand of DNA is written as follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write…

A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: Which of these molecules links the most of the individual DNA nucleotides together on the newly…

A: ENZYME:- It is defined as a complex biological catalyst i.e produced by a living organisms in its…

Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The…

A: Deoxyribonucleic acid, also abbreviated as DNA, it is the principal informational macromolecule of…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A: DNA polymerase moves along the template strand in a 3'–5' direction, and the daughter strand is…

Q: Which of the following double stranded DNA molecules would require the most amount of energy to…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: equence of nucleotides in a DNA strand is CAT TAG CAT CAT GAC, what will be the base sequence in…

A: Given: CAT TAG CAT CAT GAC: Sequence of nucleotides in a DNA

Q: How many hydrogen bonds are holding together the two strands in this double-stranded DNA molecule? 5…

A: Introduction The nitrogenous base is A molecule with the chemical characteristics of a base and…

Q: The antiparallel nature of DNA refers to its charged phosphate groups the opposite direction of the…

A: DNA strands are antiparallel to each other. They have different polarities to each other. One…

Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…

A: The answer is TTTAGCC. The last option.

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…

A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…

Q: What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand…

A: DNA replication is a process by which one parent DNA replicates to form two identical daughter DNA.…

Q: What type of chemical bonds hold together a DNA double helix? weak hydrogen bonds between…

A: DNA It is one of nucleic acid that constitutes two polynucleotide chains. These chains coil around…

Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…

A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…

Q: What does it mean that one end of a DNA strand is the 5' end? O This end has been primed 5 times.…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: a.Write out the complementary strand to the following sequence. Begin with the 5' of the end of the…

A: The Nucleotides polymers that are responsible for determining and regulating the genetic…

Q: If one strand of a DNA double helix has the sequence GTCCAT what is the sequence of the other strand…

A: By the rule of complementarity, every A is bound to T and G is bound to C.

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-AGCCTCG–3'…

A: When the structures of molecules or macromolecules match together in such a way that physical,…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: Which of the following is FALSE about DNA? O Franklin and Wilkins deduced the structure of DNA. O…

A: NOTE: The options are numbered as 1, 2, 3, and 4. Genes are the basic structural and functional…

Q: w many hydrogen bonds can be formed between Guanine and its normal ring partner in double-stranded…

A: Ans- 3 hydrogen bonds

Q: Although they are both nucleic acids, RNA and DNA carry out different functions. Which statement…

A: Nucleic acid are the biological macromolecules which form genetic material in form of DNA as well as…

Q: Cuble stranded DNA molecule of 50 base pars (100 nucleotides total) contains 15 cytosine bases (C).…

A: DNA is a double stranded helix which is a hereditary material of organisms. It contains 4 nucleotide…

Q: Which is best explanation of "Law of Base Paring?" O determines the type of protein produced allows…

A: A base pair (bp) is a basic unit of double-stranded nucleic acids, consisting of two nucleobases…

Q: What did Watson and Crick agree with Rosalind Franklin's data? DNA has two similar parts that are…

A: Cells, the most fundamental unit of life, are found in all living things. All of life's vital…

Q: The hybridization between DNA during the library screening process take place between probs and cDN…

A: b. hydrogen bond between the complementary DNA sequence

Q: One strand of DNA runs 5' to 3' the other runs 3' to 5, therefore the two strands of DNA are sald to…

A: Cell Cycle It is an ordered series of events involving cell growth and cell division that produces…

Q: What two parts of a nucleotide do not change throughout the structure of DNA? O The chromosome and…

A: DNA is composed of nucleotides- units made up of a sugar deoxyribose, a phosphate group, and a…

Q: Which of the following statements about the DNA double helix is FALSE? O The base pairs are located…

A: DNA is a double helical structure with two strands connected with a hydrogen bond. The most common…

Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…

A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…

Q: Besides replicating DNA, what is another function of DNA polymerase? O protein synthesis O…

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. The genes consist of the DNA…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: DNA is a nucleic acid molecule made of monomer units called nucleotides. The nucleotides forming DNA…

Q: How many hydrogen bonds would exist between the bases in a DNA molecule with one strand of the…

A: The hydrogen bonds in double-stranded DNA are formed between the bases. Adenine always binds to…

Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA TCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…

A: DNA is a thread-like chain of nucleotides. The order of these nucleotides determines the information…

Question

How are the two strands of double stranded DNA held together
O Covalent bonds between phosphate groups
O Hydrogen bonding between bases
van der Waal interactions
ODuct tape

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, nursing and related others by exploring similar questions and additional content below.

Similar questions

Which is not a nucleotide base in DNA? a. adenine b. guanine c. glutamine d. thymine e. cytosine f. All are in DNA.
What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
What are the base-pairing rules for DNA? a. A-G, T-C b. A-C, T-G c. A-T, G-C
Determine the characteristics of this piece of double-stranded DNA. GTCTTTTACTTGAAT CAGAAAATGAACTTA Phosphodiester bonds: _________________ Pyrimidines: _________________ Hydrogen bonds: _________________ Nitrogenous bases: _________________ A/T Ratio: _________________
ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of nucleotides. 1. Write the complementary DNA strand to the above sample. 2. Write the RNA complementary strand to the original DNA strand.
The sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA informational strand?
A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a B-form helix, with about 10.5 base pairsper turn. The DNA circle has 12 superhelical turns. What is its superhelixdensity s?
For entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Make a list of all the mistakes in the structure of this DNA polynucleotide strand.
For entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Draw the correct structure for the polynucleotide strand.
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
What forces hold the two individual strands of DNA together to form a double helix? a. ionic bonds b. covalent bonds c. hydrophobic bonds d. hydrogen bonds e. no correct response