Question

How boob generate milk

;

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Endocrinology and Reproductive Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Based on functions, label the following?

A: The flower is the primary reproductive organ present in the flowering plants. Some flowers have eith...

Q: Is nuclear power environmentally friendly and does it contribute to greenhouse gases. What are some ...

A: Click to see the answer

Q: Blood groups- How do you determine who can donate blood to whom, and who can receive blood from whom...

A: An understanding of the ABO system has provided several medical and legal advantages. Matching ABO b...

Q: The acromial region is ________________ to the otic region. (medial or lateral)

A: The acromial region is the location where shoulder bones are present.Otic region present in skull ar...

Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after perform...

A: Forward genetics screen is method used to identify the genes controlling a phenotype in the organism...

Q: If you cross a female carrier of hemophilia with a normal, healthy male, what are the chances of hav...

A: Hemophilia is the genetic disorder inherited in X-linked recessive pattern. It is a bleeding disorde...

Q: Can you please do question 15, and 16

A: Click to see the answer

Q: The citric acid cycle is frequently described as the major pathway of aerobic catabolism, which mean...

A: Click to see the answer

Q: 3) You have identified an interesting mutant in gene P. Using a Punnett square, demonstrate the cros...

A: Genes are the functional unit of heredity. Genes are made up of DNA and they carry coded genetic inf...

Q: Now calculate the slope and equation for the best fit line. You may use excel

A: Click to see the answer

Q: how is glucose reabsorbed in the proximal tubule?

A: The kidneys filter unwanted substances from the blood and produce urine to excrete them. There are t...

Q: 5.) You have identified a mutant with the following phenotype:  a) Explain what has most likely happ...

A: Mutation is the alteration in all of part of a DNA of an organism causing the increased or decreased...

Q: Diagram the hierarchy of structural levels in biological organization.

A: The levels of biological organisation includes particle starting from the atomic state to organism s...

Q: Can you please answer 10, and 11

A: Answer for 10:The primary transcript is the single-stranded ribonucleic acid synthesized from the de...

Q: what are X-linked traits, how are they inherited?  what are the diffrences between bacteria and arch...

A: Hi, thank you for your question. Since, your question consists of multiple questions, we are answeri...

Q: Please help me

A: Click to see the answer

Q: 1. Place the following list of words in the right order; from earlier to latest: Negative T cell sel...

A: Since, we only answer one question at a time, we’ll answer the first question. Please resubmit the q...

Q: 7) CRSPR-cas9 has revolutionized are ability to edit genomes. How has the CRSPR-cas9 system increase...

A: CRISPR is a family of DNA sequence seen in bacteria and archae. Cas-9: an enzyme which act as molecu...

Q: Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as a recessive allele of an X-linke...

A: G6PD deficiency is a genetic abnormality that occurs when an inadequate amount of glucose-6-phosphat...

Q: What evolutionary benefit can RNAi provide?

A: RNA interference or RNAi:It is a genetic process. In these RNA molecules inhibits the translation or...

Q: An embolus is a blood clot that has broken loose and travels in the circulation. If an embolus lodge...

A: The lodging of an embolus, a blockage-causing piece of material, inside a blood vessel is referred t...

Q: Can you please label the Femur

A: The femur:It is also known as thigh bone. In tetrapod vertebrates, it is a proximal bone of the hind...

Q: What is lac operon? Draw and/or identify the status of the lac operon in a given set of environmenta...

A: The lac operon, otherwise called as lactose operon is an example of inducible operon. It consists of...

Q: Compare    the cellular    energy (e.g. ATP)    required and produced    when glycogen is synthesize...

A: Glycogenesis is the process of glycogen synthesis, in which glucose molecules are added to chains of...

Q: 2.) Give one example of a trans-acting regulatory protein.

A: In context of transcription, a trans-acting element is usually a DNA sequence that contains a gene. ...

Q: How do you relate emergent properties to the cell cycle? How do you relate emergent properties to th...

A: Emergent property – the property or characteristics of a material is not the sum of the properties o...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: what is the physiologic significance of triglycerides?

A: Triglycerides are stored form of fats. Fats in our dietary intake are converted in to calories and u...

Q: Microbiology-Describe the physical or anatomical barriers at the following body sites, and explain h...

A: Since we are entitled to answer up to 3 sub-parts, we’ll answer the first 3 as you have not mentione...

Q: During the menstrual cycle, the degradation of the corpus luteum causes what? A) The decrease of pro...

A: The menstrual cycle is the regular change that takes place in the female reproductive system and is ...

Q: Name the three formed elements in red blood calls

A: Click to see the answer

Q: Albinism is a recessive trait controlled by a single gene. If the frequency of albinos in a populati...

A: According to the Hardy-Weinberg equilibrium, the frequencies of the alleles and genotypes in a popul...

Q: Please select all of the statements that apply to chlamydial infections.   (NOTE:  Please change all...

A: Chlamydia trachomatis:It is usually known as Chlamydia. It is gram-negative bacterium. It causes a s...

Q: If a cell was a sugar factory suggest an organelle (s) whose function would be analogous to each of ...

A: Hey there! Since you have posted multiple questions, we will answer first two sub-parts. A cell is t...

Q: Can you please do questions 17,18 and 19

A: We are authorized to answer one question at a time, since you have asked three questions, so we are ...

Q: Which of the following is not true regarding Bryophytes? Lack roots, stems and leaves Include mosses...

A: The correct answer is option (c) sporophyte is the dominant generation.In bryophytes, the dominant s...

Q: Identify why it is important to study human diseases.

A: Click to see the answer

Q: 7) CRSPR-cas9 has revolutionized are ability to edit genomes. How hasthe CRSPR-cas9 system increased...

A: Genome editing is a unique technology used to make specific changes to the cell’s DNA. It is a tool ...

Q: Can you please answer number 24

A: Answer 24. Genetic code is a set of rules used by living cells to translate information encoded with...

Q: 13) What is the purpose of the negative selectable marker in a mouse knock out cassette?  a) Why don...

A: There are three types of selectable markers used in molecular biology, positive selection marker, ne...

Q: PLEASE HELPPP

A: Click to see the answer

Q: List Koch's postulates and describe how this list supports the Germ Therory of Disease.

A: There are four postulates given by Robert Koch that allow the determination of causative microbial p...

Q: 3) You have identified an interesting mutant in gene P. Using a Punnett square, demonstrate the cros...

A: The pure breeding lines of mutant and wild type organism must be crossed to determine if the mutatio...

Q: Describe how lipids are digested and absorbed into the body, step by step.

A: Lipids are the large organic molecules and are highly water in soluble. They are the derivatives of ...

Q: Explain the phrase: “life’s dual nature of unity and diversity”. Explain how evolution accounts for ...

A: Click to see the answer

Q: What is the difference between male and female marchantia

A: Marchantia is a thalloid liverwort. It is usually seen as large colonies on damp surfaces. They are ...

Q: Describe three interesting ways relate chemistry to biochemistry and the human body.

A: Chemistry is the study of elements and compounds formed of atoms, molecules, and ions. It includes t...

Q: State the function of homeotic genes. Describe how nurse cells in fruit flies can affect larval deve...

A: Drosophila or fruit fly is taken as a model organism in genetic studies because of its less number o...

Q: Which of the following is an effector site for an ANS axon? a. Quadriceps femoris  b. Diaphragm c. e...

A: Every vertebrate has the "central nervous system" (CNS) and the "peripheral nervous system" (PNS). T...

Q: How are protein of complement system activated

A: Click to see the answer