(a) Topoisomerase II (b) DNA ligase (c) DNA polymerase y (d) Reverse transcriptase (e) DNA polymerase I (f) DNA polymerase III i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA–RNA hybrid molecule iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA intermediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replication

(a) Topoisomerase II (b) DNA ligase (c) DNA polymerase y (d) Reverse transcriptase (e) DNA polymerase I (f) DNA polymerase III i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA–RNA hybrid molecule iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA intermediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replication

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
What was the significance of Meselson and Stahl’s experiments on DNA replication using the heavy isotope of Nitrogen? A. telomerase was identified as the molecule responsible for solving the end replication problem of eukaryotic chromosomes B. the existence of lagging strand synthesis was proven. C. the rate of DNA synthesis by DNA polymerase was measured D. the processivity of DNA polymerase was established E. the semi-conservative mode of DNA replication was confirmed
Which of the following statements are correct? explain your answers.a. a bacterial replication fork is asymmetrical because it contains two DNA polymerase molecules that are structurally distinct.B. okazaki fragments are removed by a nuclease that degrades RNA.c. the error rate of DNA replication is reduced both by proofreading byDNA polymerase and by DNA mismatch repair.d. in the absence of DNA repair, genes are unstable. e. none of the aberrant bases formed by deamination occur naturally in DNA.F. cancer can result from the accumulation of mutations in somatic cells.
It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helix
Match each enzyme name in the left column with the correct descriptive phrase in the right column. (a) Topoisomerase II(b) DNA ligase(c) DNA polymerase γ(d) Reverse transcriptase(e) DNA polymerase I(f) DNA polymerase III i. Catalyzes most nucleotide incorporations in bacterial DNA replicationii. Cleaves RNA in a DNA–RNA hybrid moleculeiii. Uses a tRNA primer in synthesis of retroviral DNAiv. Acts through an adenylylated DNA intermediatev. Catalyzes formation of a double-strand DNA breakvi. Catalyzes mitochondrial DNA replication
During DNA replication, short RNA primers are made by the Primase. Why? a. To provide a 3'-OH so DNA polymerase can begin DNA synthesis. b. To recruit single stranded binding proteins to the correct location. c. To identify the termination sequence for DNA polymerase during DNA synthesis. d. To provide a 3'-OH so RNA polymerase can begin DNA synthesis. e. To identify the origin of replication to recruit the origin replication complex to the correct genomic location.
Polymerases usually add only about 10 nucleotides to a DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands of nucleotides at a moving fork. How is this addition accomplished?
Which of the comparisons between DNA polymerase and RNA polymerase is false? -Both DNA polymerase and RNA polymerase have proofreading activity. -DNA polymerase requires an additional enzyme to unwind double-stranded DNA molecules, but RNA polymerase does not. -Both DNA and RNA polymerase catalyze the addition of nucleotides to the 3’ end. -DNA polymerase needs a free 3’-OH to begin the polymerization reaction, but RNA polymerase does not.
Nobel Laureate Linus Pauling famously argued that the structure of DNA was a triple helix. Perhaps he was studying DNA from the fictional Planet Triplon, where that indeed appears to be the case! You perform an elegant experiment based on Meselson and Stahl's PNAS paper from the 1950s to test how DNA on this planet is replicated, and find evidence consistent with a conservative mechanism for replication! Indicate the basics for how this experiment works and clearly draw your results. Contrast with how your results might look if the semiconservative model were correct. (You have room to be creative because the exact mechanisms of DNA replication on this planet remain to be discovered.)
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Regarding the process of DNA replication, it is correct to state that: a) Nucleosomes are maintained during the DNA polymerase-mediated replication process b) The phosphodiester bonds that join the nitrogenous bases maintain the integrity of the DNA strands c) DNA polymerase requires a previously annealed deoxynucleotide to add the next monomer being synthesized. d) The action of the helicase decreases the twist caused by the movement of the replication complex along the stretch of DNA e)