If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand А T A А А G T А T T T A G

A: Assuming the given sequence is sense strand of the DNA. The sense strand is in the direction 5’-3’.…

Q: The 5' end of an mRNA corresponds to the __________ end of a protein. Question 27 options: A) 5'…

A: Biological molecules are those large molecules that are found in the cells of an organism which are…

Q: The genetic code is defined as a series of _______________ in _______________.   (a) anticodons;…

A: The genetic code, anticodons, codons, mRNA, and tRNA are all involved in the expression of a gene. A…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: How many 3 base sequences are in the Genetic Code? 12 20 22 64

A: The DNA code is read by the cell in three-base groups. Each codon, or triplet of bases, determines…

Q: Which component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomes

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript, which was…

Q: Codons are found on __________ and they contain __________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3…

A: Codons are found on mRNA and they contain 3 bases. The genetic code is the stored genetic…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: During transcription, 1 nucleotide of DNA corresponds with ________ nucleotide of RNA:

A: Answer: Transcription : It is the process in central dogma during which DNA is transcribed in to…

Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?

A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…

Q: Transcription produces O proteins from RNA. O proteins from DNA. DNA from RNA. O RNA from DNA.

A: Note- According to the guidelines, We are supposed to answer only 1st question. Please repost other…

Q: If the sequence of bases in the coding strand of a DNA molecule isTAGC, then the sequence of bases…

A: Introduction  The DNA/gene give rise to the formation of mRNA by the process called gene…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Anticodons pair with_____ . a. mRNA codons c. RNA anticodons b. DNA codons d. amino acids

A: Translation is the process by which proteins are formed in the cytoplasm using ribosomes and mRNA.…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: Write the polypeptide sequence that would be translated from your mRNA sequence.

A: Answer -  The DNA sequence will be -  5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…

Q: An RNA sequence includes 15 bases. How many amino acids does this sequence encode? 3 0 5 O 15 O 45

A: RNA is a molecule that consists of a single strand of nucleotides. It is a product of transcription…

Q: what enzyme is needed to make mrna

A:

Q: Which of these pieces of a gene will ultimately be read by the ribosome to produce a protein?…

A: Pieces of genes introns and exons are actually nucleotide sequence within a gene. There is an…

Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48

A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.

Q: An MRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? O a.5 CTA 3' O b.5 GUA 3

A: Every tRNA contains a trio of bases, called an anticodon, and ties at a space away from the trio to…

Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU

A: Introduction The molecule that carries the genetic information necessary for an organism's growth…

Q: What is the maximum number of amino acids that can be encoded by a gene with 45 bases plus a stop…

A: The triplet code is comprised of three bases encoding for one amino acid. Thus, 15 amino acids can…

Q: How many “letters” of an RNA molecule, in sequence,does it take to provide the code for a single…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: how does a dna molecule code for a protein

A: Deoxyribonucleic acid or DNA is a molecule that comprises of two polynucleotide chains that wound…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: How many mRNA nucleotides does it take to code for a polypeptide that is 30 amino acids long?…

A: on the mRNA, we have codons that code for very specific amino acids. we have 61 codons that code for…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: what 3 parts make up processed piece of mRNA

A: A post-transcriptional modification takes place after transcription of DNA to mRNA strand in the…

Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…

A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…

Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…

A: Introduction  Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: How many unique MRNA codons can be constructed from the four different RNA nucleotides? A. 4 В. 8 С.…

A: mRNA codon:- An mRNA codon is a 3 base pair long part of the mRNA that codes for a specific amino…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: In which direction in mRNA produced? 1. C terminal to n terminal 2. N terminal to c terminal…

A: mRNA:             A DNA template of nucleotide sequence is synthesized in the nucleus which owing to…

Q: Which of the following molecules is used to transfer the genetic code from the nucleus to the…

A: Proteins are large biomolecules that play a significant role in the physiological activities of the…

Q: What is the corresponding mRNA sequence of the polymer? 3'CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5'

A: Translation is a process which takes place on the ribosomes. It is step of protein synthesis where a…

Q: If the sequence of a coding strand of a gene is 5' ATGGCAT 3', the sequence of the MRNA would be:…

A: DNA stores genetic information. The nucleotide sequence of DNA has the information which codes for…

Q: What protein is responsible for reading the mrna strand and creates protein(polypeptide)

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand A т G А A A G T А T т T А G

A: Gene expression is the process by which the information from a gene is used in the synthesis of a…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is :   a. 4 b. 5…

A: The three letter codes for amino acids are the universally accepted amino acid codes that are…

Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…

A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…

Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…

A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…

Q: Coding strand CGT CTC TTC GGA CAC whar is the mRna strand

A: The process of formation of mRNA sequence  from the template strand of DNA is known as…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.