If you were to set up a PCR reaction (in vitro DNA synthesis) with a DNA template, primers,DNA polymerase, DATP, dGTP, dCTP, dTTP and a small amount ofddATP, what would be the result?DNA synthesis would happen normally.All DNA molecules produced would be the same length as the template.DNA synthesis might be terminated after the addition of any adenine base (at random).DNA molecules of many different lengths would be produced.DNA synthesis would be terminated after the first adenine base is added.All DNA molecules produced would the same length, shorter than the template.

PCR is an in vitro technique for the DNA synthesis. It is used to generate the multiple copies of…

Answered: If you were to set up a PCR reaction…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

The PCR reaction contains deoxynucleotide triphosphates (dNTPs) in order to construct new DNA. There are four different dNTPs used in this reaction. Which answer below lists the four different dNTPs used in PCR? A) DNA polymerase, helicase, ligase, topoisomerase B) adenine, guanine, cytosine, thymine C) adenine, guanine,cytosine, uracil D) Alanine, guanine, cytosine, Theron one
During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72 degrees Celsius) multiple times. What happens during the 94 degree part of a cycle? Group of answer choices Double-stranded DNA denatures and becomes single-stranded. DNA polymerase synthesizes daughter DNA molecules. An oligonucleotide primer anneals to a template DNA strand.
During the process of Gel Electrophoresis, DNA will move through the gel towards the-------end of the gel, based on DNA having an overall------charge and the-----DNA fragments will travel the furthest. Choose from the following answers: negative, positive, smallest, largest, medium
PCR is an exponential copying of the template strands and can be represented by the function: y = a * 2n, where a is the initial number of template copies and n is equal to the number of cycles PCR has gone through. How many DNA fragments would be produced after: 15 cycles? 13 cycles with 13 starting template strands? 29 cycles with 32 starting template strands?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
Which of the following subunits of DNA polymerase has proofreading ability? a. α b. β2 c. θ d. None of the above
An important feature of restriction enzymes is that each enzyme only recognizes a specific palindrome and cuts the DNA only at that specific sequence of bases. A palindromic sequence can be repeated a number of times on a strand of DNA, and the specific restriction enzyme will cut all those palindromes, no matter what species the DNA comes from. A linear DNA molecule is represented below. The DNA is represented by one line, although in actuality, DNA has two strands. If the DNA molecule has two restriction sites, specifically two repeats of a specific palindrome sequence, A and B, for a specific restriction enzyme: How many fragments would be produced if the DNA is cut by that enzyme? Number each fragment Which fragment would be the largest? Which fragment would be the smallest?
A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 only
PCR (polymerase chain reaction) is an excellent method of generating copies of target DNA. If a single piece of double stranded DNA (dsDNA) is put into a PCR machine, how many dsDNA segments will there be after 3 rounds? A. 8 segments, with 2 original strands paired B. 16 segments, with 2 original strands on different segments C. 16 segments, with 2 original strands paired D. 8 segments, with 2 original strands on different segments
PCR is a molecular biology technique where template DNA is amplified using a primer and oligonucleotides. The reaction is catalyzed by a thermostable DNA polymerase and in a particular reaction, the template strands are denatured at 95˚C. For strand hybridization, the melting temperature is 55˚C. What do you predict about the average duration of H bonds at the high temperature in comparison to the low temperature?
Which of the following describes an advantage of using a recombinant plasmid for DNA cloning over PCR? A. PCR is more likely to have errors introduced in the copying process. B. Recombinant DNA plasmids are able to create large amounts of copies more quickly than PCR. C. PCR can only be conducted in eukaryotic cells. D. PCR requires prior knowledge of the sequence in question, while a recombinant plasmid does not.
The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does the number of copies of the DNA region being amplified change at the end of each cycle of the polymerase chain reaction? Group of answer choices a. The number of copies triples (or triplicates). b. The number of copies does not change. c. The number of copies quadruples (or quadruplicates). d. The number of copies doubles (or duplicates). e. The number of copies halves.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS