iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome nucleotides DNA polymerase topoisomerase elicase leading strand lagging strand replication fork
Q: What effect does a thymine dimer have on DNA synthesis?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Unzipped Single Strand of DNA Complementary Strand of DNA Build the complementary strand of DNA to…
A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…
Q: Match the statement to the corresponding agent/key player in DNA replication. Some items require…
A: DNA replication is the biological process where a double-stranded DNA molecule is copied or…
Q: Labeling DNA Replication rections: Drag the labels from the left to correcly dentify the parts of a…
A: DNA replication is a process in which two strands are formed from the original strand. Origin is the…
Q: DNA ligases cannot join the sticky ends of two DNA fragments. True False
A: The DNA ligases are used in the process of cloning in which pieces of DNA having matching ends are…
Q: Statement Replication Transcription The new strand is made 5' to 3'. The new strand is made 3' to…
A:
Q: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA sequence:…
A: Process by which DNA is copied to mRNA is called transcription. Process by which mRNA is used to…
Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:
A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…
Q: DNA replication AND repair both finish with the action of Primase DNA polymerase l DNA polymerase II…
A: Primase- Primase is an enzyme that produces primers, which are short RNA sequences. Primase works by…
Q: Match each statements below with the appropriate letter from the replication fork diagram. 1.…
A: 1. Removal of RNA primers and joining of Okazaki fragments. Because of its 5′ to 3′ exonuclease…
Q: COMPLEMENTARY
A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below
Q: The heterochromatin dissipates during Replication Recombination O Transcription None of the above
A: Transcription is a process of conversion of information in the DNA into RNA in the nucleus of the…
Q: Which of the following enzymes can recognize and remove a damaged DNA base to leave an apurinic or…
A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…
Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…
A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: copy of a molecule of DNA. In this process, the joining of nucleotides to extend a new strand of DNA…
A: DNA replication is a process in which DNA makes its daughter stand by making a copy of the original…
Q: What is a replication fork?
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: Name of Enzyme Function Helicase Topoisomerase DNA polymerase Ligase 7. Make a list of steps that…
A: The tightly packed genetic material located in the nucleus of a living organism which is made up of…
Q: Acts at oric to initiate DNA replication by denaturing dsDNA Choose... Counteracts topological…
A: DNA replication is a complex process which involves replicating another strand of DNA according to…
Q: will synthesize the in short pieces that are linked together by the enzyme , but the is made…
A: Deoxyribose nucleic acid (DNA) is the genetic material for almost all living organisms. DNA is a…
Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
A: Above table is codon anti-codon table for translation of DNA code into protein sequence.
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate…
A: The course of replication is done with the assistance of various enzymes, for example, helicase, DNA…
Q: DNA Replication Topoisomerase Match the diagram with the correct term listed below. Structures…
A: Ans : The correct representations are : * Okazaki fragments - C (Short pieces of DNA, synthesized…
Q: Label the figure to assess your knowledge of DNA replication. Drag the appropriate labels to their…
A: The given diagram shows the replication of the DNA.The DNA replication can be defined as a process,…
Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…
A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…
Q: Complete the complementary strand: DNA replication ATTCGAGGCTAA
A: DNA (deoxyribonucleic acid) replication is the fundamental process occurring in the cell by which…
Q: Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb.…
A: DNA replication is the process of producing two similar replicas of DNA from one original DNA.
Q: GIVEN: DNA CODING STRAND: GCG TAC TTT TCA GGT DNA TEMPLATE STRAND ____ ____ ____ ____
A:
Q: Holds the processive enzyme in prokaryotes Start of replication in prokaryotes Holds the processive…
A: 1. SSBP helicase holds processive enzymes in prokaryotes 2. Replication starts at ORI C ORIGIN OF…
Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase…
A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This…
Q: All of the following are involved in DNA replication excepta) polysome. b) gyrase. c)…
A: DNA is the genetic and hereditary material in all living organisms. When a cell divides, DNA is…
Q: Which of the following is not necessary for replication to proceed? O MRNA RNA primer DNA polymerase…
A: The answer is m-RNA.
Q: Match the enzymes given below with their correct placement on the diagram. Record your answers onto…
A: The process by which a DNA molecule is copied to two identical DNA molecules is known as DNA…
Q: Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer…
A: DNA is the genetic material of almost all the organisms, except few viruses and is present in the…
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Repilication fork Triphosphate…
A: During the DNA replication, the double helix structure of the DNA needs to be breakdown into a…
Q: Name 4 proteins present at a replcation fork during DNA replication and tell what they do. ITIE1 0…
A: DNA replication is a process in which DNA makes a copy of itself during cell division.
Q: Which kind of chemical damage is depicted in this picture: IN H,N NH3 SARA NH DNA DNA Selar Base…
A: Base deletion is a type of mutation in which a base is deleted from DNA. Strand breakage is a…
Q: Cuble stranded DNA molecule of 50 base pars (100 nucleotides total) contains 15 cytosine bases (C).…
A: DNA is a double stranded helix which is a hereditary material of organisms. It contains 4 nucleotide…
Q: 1 Two DNA double helices are formed, showing semi- conservative replication (show what this means).…
A: Deoxyribonucleotide (DNA) is a molecule that carries genetic material in all living organisms. It…
Q: The DNA polymerase involved in base excision repair isa) DNA polymerase αb) DNA polymerase βc) DNA…
A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…
Q: Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication…
A: Introduction : DNA replication is the process through which daughter DNA is formed from parental…
Q: Match each DNA Replication enzymes on the left with its function I) DNA Ligase II) DNA Polymerase II…
A: Introduction The process by which a double-stranded DNA molecule is copied to produce two identical…
Q: Guanine was oxidized into 8-oxoguanine, which process below will ensure the integrity of the DNA?…
A: DNA repair system specifies a collection of processes, through which a cell identifies and corrects…
Q: Label the parts of the DNA replication fork. DNA ligase Leading strand Okazaki fragment DNA…
A: DNA replication, as used in molecular biology, is the biological method for creating two identical…
Q: Ku proteins involve. nucleotide excision repair DNA repair before S phase single DNA strand break…
A: The Ku proteins bind to the ends of the linear phage DNA and stimulate LigD to ligate the ends to…
Q: A biochemist isolates, purifies and combines ina test tube a variety of molecules needed for DNA…
A: According to the central dogma of molecular biology, DNA is converted to RNA (transcription) and RNA…
Q: Several proteins involved in DNA repair are used in multiple pathways. Which one of the following is…
A:
Q: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-CT-CGT-3 DNA daughter strand: hnRNA: MRNA: original…
A: Replication occurs in a bidirectional manner. Always happens in the 5'→3' direction because…
Step by step
Solved in 2 steps
- View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-kWhat enzyme breaks the H-bond between nucleotides of DNA? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase IIItrue or false: DNA polymerase III performs nick translation.
- Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’Can you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHCOMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCWhich of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments) during DNA replication? Group of answer choices DNA gyrase Helicase Primase DNA polymerase DNA ligase
- Which enzyme catalyzes the elongation of a DNA strand in the 5' to 3' direction? Group of answer choices DNA ligase primase DNA polymerase I DNA polymerase IIIRe-write the following false statement to make it true: A bacterial replication fork is asymmetrical because it contains two DNA polymerase molecules that are structurally distinct.DNA Fingerprinting Analysis Case: Mr. Chan’s family consists of mom, dad, and four kids. The parents have one daughter and one son together, another daughter is from the mother’s previous marriage, and the other son is adopted. Here are the DNA analysis results: QUESTIONS: Which child is adopted? Which child is the mother’s previous marriage? Who are the own children of Mr and Mrs Chan?