III. Microbes that can survive and thrive in extreme environments are known as extremophiles. In this context, what is the most accurate term that can be used to describe microbes that are used in vinegar (pH 2-3) production? A. B. C. D. Halophiles Acidophiles Thermophiles Psychrophiles

III. Microbes that can survive and thrive in extreme environments are known as extremophiles. In this context, what is the most accurate term that can be used to describe microbes that are used in vinegar (pH 2-3) production? A. B. C. D. Halophiles Acidophiles Thermophiles Psychrophiles

Body Structures & Functions Updated

13th Edition

ISBN:9780357191606

Author:Scott

Publisher:Scott

Chapter16: Infection Control And Standard Precautions

Section: Chapter Questions

Problem 6RQ

See similar textbooks

Related questions

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: For a microbial cell to grow at its maximum specific growth rate, which of the following conditions…

A: The specific growth rate is a measure of the rate at which a microbial population increases in size…

Q: What role does forensic entomology play in crime scene investigation, and how can the study of…

A: Forensic entomology is a branch of forensic science that utilizes insects and other arthropods to…

Q: Controls the outputs of the cortex and regulates motor activity. Central pattern generators.…

A: The segmental level refers to the neural processing that occurs at the level of the spinal cord. It…

Q: The second step in viral replication is entry. For bacteriophage, entry usually involves: O a)…

A: A virus is an obligate parasite which have small piece of genetic material. This genetic material…

Q: what is the problem statement of conservation status of fish BARNARD’S ROCK CATCFISH (AUSTROGLANIS…

A: The catfish species Austroglanis barnardi belongs to the threatened Siluriformes group. It is one of…

Q: What is an open-reading frame? a) An unknown gene b) The protein-encoding sequence of a gene c) A…

A: ORFs are commonly found within genes, which are segments of DNA that contain the instructions for…

Q: Enhancers promoters changing transcription potential insulator sequence translation distant the same…

A: 1. Enhancers can regulate genes from a distance, and yet they influence expression of only some…

Q: Dichotomous key construction. Create a dichotomous key using the genera/species and characteristics…

A: Dichotomous KeysA dichotomous key is a tool that allows the user to determine the identity of items…

Q: 5. What is the difference between Smooth and Rough ER? . What is the difference between a lysosome…

A: The endoplasmic reticulum (ER) is a complex network of membranes within the eukaryotic cell that…

Q: NOT a DNA-based method

A: This is a method which refers to the technique or approach that utilizes the DNA molecules or…

Q: What is the major source of mass of General Sherman’s body? How do these trees build such large…

A: A massive sequoia tree in Sequoia National Park in California, United States, is known as General…

Q: The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the…

A: We'll look at three distinct mutations that were discovered in a wild-type gene sequence in this…

Q: To further investigate the cellular response in photoreceptor cells, we will now look at the actual…

A: cGMP stands for cyclic guanosine monophosphate. It is a small molecule that serves as a second…

Q: What are the key factors that affect the success of cell culture techniques in a laboratory setting?

A: Choosing an appropriate cell line for the intended purpose is essential. Factors to consider include…

Q: Bacteriophage P22 was used in generalised transduction experiments to infect the Salmonella…

A: The horizontal transfer of the genetic material from donor bacteria to the recipient bacteria via…

Q: In each of the following pedigrees (C, D) by inspection, determine the mode of inheritance involved.…

A: A pedigree is a graph that shows a family's genetic history over numerous generations. Women are…

Q: How viruses are inhibited by interferons

A: VirusesThese are microscopic infectious agents that infect living organisms. They depend on the…

Q: Among the tetrapods, reptiles evolved a key adaptation that allowed them to become fully independent…

A: Evolution is the process of change over time in the inherited characteristics of a population of…

Q: What is the speed of cellular response, genomic vs. non-genomic response (liposoluble or lipid non…

A: Hormones are low molecular weight chemical messengers produced by the endocrine glands directly into…

Q: How do emotions impact the physiological and neurological processes in the human body?

A: Emotions are integral to human experiences, influencing our thoughts, behaviors, and physiological…

Q: You are interested in examining the internal structures of a living cell, what type of microscopy…

A: One type of instrument by which we can see small object even the internal structure of any cell is…

Q: 3. Chemical X inserts channels into bacterial cell membranes. Rhodospirillium, a purple non-sulfur…

A: Photosynthesis is a pathway by which all plants and some bacteria produce energy by utilizing carbon…

Q: 3. In the following diagram, determine the type of transport protein in A. Justify your answer with…

A: Active transport is a kind of membrane transport in which the molecules moves from the lower to…

Q: Give typing answer with explanation and conclusion As a consultant plant pathologist, a commercial…

A: As a consultant plant pathologist, I would suggest the following four possible control measures to…

Q: which of the following would signal enzymes to produce more energy? there may be more than one…

A: ADP is an important molecule in cellular metabolism and energy production. It is formed when ATP…

Q: For questions 1-3; indicate whether the sentence or statement is true or false. If false, rewrite…

A: Living organisms need energy for doing cellular activities and this energy is produced by the…

Q: Q4. There is no bioavailable glucose or carbohydrates on Kepler-28d. Given the harsh conditions on…

A: Kepler 28d is an exoplanet orbiting around the star named kepler. It is about 1400 light years away…

Q: 22 38 38 38 la 1b 2a 2b 3a 3b 4a 4b 5a 5b Solitary bat Colonial bat. >35-cm wingspan 35-cm wingspan.…

A: A dichotomous key is defined as an identification technique that repeatedly divides groups of…

Q: what are the qualities of the third phosphate bond in ATP? there may be more than one. - stable -…

A: Metabolism can be defined as the collection of all the chemical reactions involved in maintaining…

Q: You measure your patient's fasting blood glucose 5 times in 30 minutes on a small glucometer. You…

A: Blood glucose concentration is regulated by the activity of two pancreatic hormones that are insulin…

Q: Using the phylogenic tree below, answer the following questions: -Species A -Species B -Species C…

A: Phylogenetic tree: A phylogenetic tree is a branching diagram or tree which is used to illustrate…

Q: If appropriate, give an overview of a skin disorder and the latest key statistics on the disorder of…

A: Acne is special type of inflammatory skin disorder that occurs when hair follicles plug with oil and…

Q: further half-life no longer uptakes accumulate(s) decay how long it took faster uptakes remains…

A: By decay of nitrogen present in radiocarbon (carbon-14), we determine the age of an organism. Carbon…

Q: In oxygenic photosynthesis, microbes such as Cyanobacteria use light energy to produce oxygen by…

A: a) Water is a critical component of oxygenic photosynthesis because it is the source of electrons…

Q: 1. Plate count data are used to calculate microbial population density as colony forming units…

A: Serial dilution is the method to calculate the micro-organisms in the sample. In this method, the…

Q: How can healthcare professionals find a balance between protecting public health and maintaining…

A: Healthcare professionals should be familiar with and adhere to legal and ethical guidelines such as…

Q: Briefly explain the rationale for deciding on sample size for a population study. Identify Three…

A: Due to practical constraints including time, money, and resources, it is frequently difficult for…

Q: Popcorn (Organics) Case Study Questions Questions: 1. According to Kate, what is the secret of…

A: "According to our guidelines, we are supposed to answer only three sub-parts of the question. Please…

Q: What are different methods used to render cells competent?

A: Cell is the basic biological unit of life. Each organisms are made up of cell.Competent cells are…

Q: I'm doing my project on CO2, one of the prompts is "Describe the usage including relevant energy…

A: Carbon dioxide (CO2) is a colorless and odorless gas composed of one carbon atom bonded to two…

Q: In glycolysis, the conversion of phosphoenolpyruvate (PEP) to pyruvate is considered irreversible.…

A: Glycolysis and gluconeogenesis are two interconnected metabolic pathways that play essential roles…

Q: Consider a polymeric membrane within a 6 cm diameter stirred ultrafiltration cell. The mem- brane is…

A: Proteins can be effectively separated using ultrafiltration because they have two properties that…

Q: Chloroplasts most likely originated from which of these independent organisms? a) Cyanobacteria b)…

A: Plant cells contain numerous structures that are not found in eukaryotes. In particular,…

Q: Give typing answer with explanation and conclusion

A: Global warming refers to the long-term increase in Earth's average surface temperature, primarily…

Q: mimicry? followin an example of a snapping turtle that uses its tongue to mimic a worm, thus…

A: Mimicry is the adopting behaviour of organisms. One organism behaves like other organisms or…

Q: Question 1 Interpret why halophilic lactic acid bacteria (HLAB) isolated from environmental samples…

A: Humans have incorporated fermented foods into their diets because of their multiple health…

Q: Use the data below to calculate the colony forming units per mL (CFU/mL) from a sample of bacteria…

A: Serial dilution is the method to calculate the concentration of the micro-organisms in the sample.…

Q: 8. Which of the following is not a feature of voltage-dependent ion channels? A. It has a…

A: Voltage-dependent ion channels are transmembrane proteins that are essential for the generation and…

Question

III.
Microbes that can survive and thrive in extreme environments are known as
extremophiles. In this context, what is the most accurate term that can be used
to describe microbes that are used in vinegar (pH 2-3) production?
A.
B.
C.
D.
Halophiles
Acidophiles
Thermophiles
Psychrophiles

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Term to describe microbes used in vinegar production with a pH range of 2-3

VIEW

Step 3: Explanation of incorrect options

VIEW

Solution

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The majority of heterotrophic bacteria are (a) free-living chemoheterotrophs (b) photoautotrophs (c) chemo-autotrophs (d) facultative anaerobes (e) obligate anaerobes
1.) During a laboratory activity, Chemical reactions from mixture of chemicals should be observed under which laboratory equipment? a.) autoclave b.) fume hood c.) Labaratory Safety cabinet d.) Centrifuge 2.) Which type of equipment contains a HEPA filter that only removes suspended materials from exhausted air? a.) Fume hood b.) Biosafety Cabinet I c.) Biosafety Cabinet II d.) Biosafety Cabinet III
1. Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph d. Obligate anaerobe e. Facultative anaerobic f. Coliform
1(a)What is a psychrotroph? (b)From what natural sources would you isolate a thermophile? A psychrophile? (C)How does temperature affect the growth of a microorganism? (D)State the temperature class for Escherichia coli, Bacillus sp, Aeromonas sp, Micrococcus luteus, and suggest their optimum growth temperature. 2 (a)Why is dilution important when determining microbe number? (B)How does a decrease in dye colour intensity affect the microbe ? (C)State the possible sources of error if plate counts and colour intensity of dilutions are incorrect or Precautions taken to prevent this from happening. ( this is not a graded assignment)
A microbe causing a bloodstream infection is likely all of the following except A. A chemotroph B. A parasite C. A heterotroph D. A thermophile
A type of bacteria that can only grow in a medium with no oxygen would be referred to as a(n) _______. Question 10 options: A) obligate aerobe B) obligate anaerobe C) microaerophile D) facultative anaerobe
Requires oxygen at a lower concentration than typically found in air. Question 3 options: a) Obligate aerobe b) Facultative anaerobe c) microaerophile d) None of the above
8. A retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend product shelf life. b) Food is heat-sterilized first, and then added to a pouch under nitrogen c) Retort pouches requires thermally stable seals d) Both a and c
Extreme thermophiles (hyperthermophiles) are active a. in temperate zone soils on hot, sunny days. b. in recently fallen meteorites that are still too hot to handle with bare hands. c. in very hot geothermal environments. d. in steel mills. Enrichment of a fast growing bacterial species from a sample in which it is not abundant may employ: a. Serial dilution using sterile physiological saline or other common diluent. b. Inoculation and incubation through multiple transfers to fresh media. c. Preincubation in the refrigerator. d. Use of beer as a medium supplement. Which of the following sequences of electron carriers could represent a workable bacterial electron transport chain? a. cytochromes, followed by an iron-sulfur protein, and quinones. b. quinones, cytochromes, iron-sulfur proteins, and a flavoprotein. c. a flavoprotein, followed by an iron-sulfur protein, quinones, and cytochromes.…
Can you give me an example of a specific medium in culture media and fill the information below. General Information Specific a. Name of medium: b. Physical form: c. Category based on formulation: d. Purpose/uses/function: e. List of Ingredients and concentration (per 1000 ml) f. How to prepare?
1. Why is it the Fluidized Bed Bioreactor is important in the biological wastewater treatment compare to other bioreactors?
Explain the reasons why the Poon Choi is the high risk food for the elderly? It would be easily spoiled if you found the condensed water on the inner side of the cover lid of the container, and also if you put it at room temperature for more than two hours. Explain in term of the factors of microbes growth. Explain it in detailed.