In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.

Q: pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Plasmids are double-stranded circular DNA found in bacteria. These contain genes related to…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: Assuming the 35S promotor sequence is 500 base pairs long, with the electrophoresis results, what…

A: 35s promoter derived from the cauliflower mosaic virus is a promoter sequence used to enhance the…

Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…

A: Transposons are called jumping genes they change their position within a Genome.

Q: The human genome 3.4 Gb would be 2.3 meters long if stretched linearly.In not more than 200…

A: Dna is wrapped around nucleosomes.

Q: The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words,…

A: The size of a genome varies depending on the complexity of the genomes of different species.

Q: When performing a database search, what is the definition of an E-value? A. The chance that a random…

A: The sequences can be found as a query in a database by aligning it to the database sequence and come…

Q: In extracting and Isolating a DNA from yeast and fruit. • What is the role of salt and dishwashing…

A: DNA is the genetic material of most cells and its extraction is necessary for analysis,…

Q: If “the human genome sequence” does not really exist, can you think of better ways in which we might…

A: Human genome sequence projects initially started in 1990. Its aim was to completely sequence all the…

Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…

A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Q: What were the two major goals of the Human Genome Project? Select all that apply.   a to isolate…

A: Introduction :- The Human Genome Project was an international scientific research project aimed at…

Q: The human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200…

A: A gene is a segment of a DNA molecule, but DNA fragments smaller than a gene may exist. The DNA of a…

Q: if one base pair of DNA weighs 650 kDA, how much does the entire human genome with 3.3x109 weigh?

A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you…

Q: The following DNA sequence is part of one exon and contains the beginning of a gene’s open reading…

A:

Q: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total…

A: The mitochondrial DNA (deoxyribonucleic acid) is 16.6 kilobase pair long that contains 37 genes. It…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: What does SDS–PAGE stand for? What is the benefit of doing SDS– PAGE?

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein…

A: The Smith-Waterman algorithm uses local sequence alignment to find similar regions between two…

Q: Approximately how many base pairs were identified in the human genome working drafts?

A: The human genome project is a scientific project led by James Watson and Francis Collin, started in…

Q: The Japanese canopy plant (Paris japonica) has one of the largest of all eukaryotic genomes, with…

A: Genome or genetic material of an individual is the whole set of genes present in the chromosomes of…

Q: Next-generation sequencing reveals that six new mutations have occurred in the coding regions of…

A: Mutations are sudden heritable changes in the genetic make up of an organism because of several…

Q: What is the principle behind the very specific sequence in donning and doffing PPEs? Explain

A: PPE -- refers to the personal protective equipments which help against the spread of infection and…

Q: In 1953, Watson and Crick discovered the structure of DNADNA by examining data from many different…

A: Humans and practically all other species have deoxyribonucleic acid or DNA as their hereditary…

Q: Given our knowledge of genome sizes in different organisms, would you predict that Homo sapiens or…

A: The hereditary material that transfers from one generation to another present in the nucleus of the…

Q: What is meant by the phrase reading frame?

A: The genetic sequence is comprised of nucleotides, which are joined together to form polynucleotides…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…

Q: The median size protein in humans is 8600 amino acids. How does this compare to if our genome was…

A: Proteins are polymers of amino acids linked by peptide/amide bonds. It is expressed inside the cells…

Q: if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment…

A: Aligning one or more sequences by introducing gaps is termed as gap penalty method. The introduction…

Q: In a genomic analysis looking for a specific disease gene,one candidate gene was found to have a…

A: The discovery, measurement, or comparison of genomic properties such as DNA sequence, structural…

Q: The following is a representation of the tree of COVID 19 genomes based on relatedness of the…

A: Introduction:- Tree of genomic represent the relationship between different organisms.This means…

Q: If pET32a(+) is digested simultaneously with BamHI and BclI, 1.How many fragments are created? 2.…

A: Cells contain nucleic acid which stores essential genetic information for the survival of the cell.…

Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…

A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…

Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…

A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper…

A: "Since you have posted a question with multiple questions, we will solve the first question for you.…

Q: Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to…

A: Next-generation sequencing relies on the continuous sequencing of the genome parts and later…

Q: In the extraction of DNA from a Banana, alcohol is added to the filtrate after filtration. What will…

A: Extraction of DNA from Banana:  Bananas are excellent source of dna for extraction because cells of…

Q: The following image depicts a short stretch of sequence associated with a gene. Which of the…

A: The given DNA strand is as follow 5'- AACTATAAGCCTTGGCCGATTCGATGCTAAATTGCGCATAA-3 We know DNA has…

Q: The human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200…

A: The genome size varies according to the complexity of the genomes of various organisms.

Q: Given the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the…

A: Nucleotides are the chemical compounds that constitute the nucleic acids. The nucleic acids are of…

Q: 5'-ATGTCCACTGCGGTCCTGGAAAACCCAGGC-3’ wild-type allele 3'-TACAGGTGACGCCAGGACCTTTTGGGTCCG-5’…

A: The term mutation refers to the alternations in DNA sequences. The chemicals or other substances…

Q: What is the Lineweaver-Burk plot and what does it tell us?

A: The study of the rate of enzyme-catalyzed biological reactions is known as enzyme kinetics. In…

Q: You have sequenced the genome of the bacterium Salmonella typhimurium and a protein that is 100…

A: The protein sequence is dependent on the DNA sequence. When DNA is transcribed, it forms mRNA and…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: DNA is a double-helix structure that is made up of two intertwined polynucleotide strands that are a…

Q: n a pUC19 digest for 1 ug of pUC19 (DNA conc. 282ng/ul) using 10X Cutsmart buffer, pure water and…

A: Restriction digestion is a process by which restriction endonuclease (eg. BamHI) cuts the DNA at a…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   What human disease has been connected to this gene?…

A: The given sequence  CCACCTGTACCCGGACACACCCTGGTGTCC is a protein sequence that encodes the protein…

Q: What is the difference between the core genome and pan-genome? What might you infer if you compare…

A: The core genome and pan genome are mentioned in the field of molecular biology. The core genome and…

Q: If I take random biological sequences from a data bank, I see even more sequence similarity. Why ?

A: BLAST stands for the Basic local alignment search tool. It is available through the web portal of…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.