In Python,  A sales event at Trader Jane's is reducing some items by 25%. Store that value to a properly named constant. Write a program that functions like a cashier terminal for one item. Some items are subject to 7% sales tax and some are not. Use a constant for the sales tax value, too. Write a program for Trader Jane's that runs as shown next: Enter the ticket price of the item 100 Is this item reduced y/n? y is this item taxable y/n? y Here is your bill Original price $100 Reduction during event $25.00 Final price $75.00 7% Sales tax $5.25 Total amount due $80.25     Plan each program by writing pseudocode. Write all of your pseudocode as comments immediately after your name and SPC ID#.  Add more comments as needed in each program to explain your code. Choose descriptive variable names in all programs. Currency format. There should be no space between the $ sign and the first digit. See sep on page 66 to cancel the space automatically added when print items are separated by commas. Display commas as needed for values over $1,000.

Q: Write a python program: Let the user specify S (the number of sides on a die) and N (the number…

A: Import the random library and prompt the user for the values of N and S. Use a for loop for N times…

Q: Create a program in python wages.py that assumes people are paid double time for hours over 60. They…

A: The required Python code is: import randomimport winsound  hourRate=float(input("Enter the hourly…

Q: Write a Python program that prompts the user for the cost of two items to be purchased. Then prompt…

A: PROGRAM EXPLANATION: Start. Take the cost of the first item as input. Take the cost of the second…

Q: Write a program that calculates and prints the bill for a cellular telephone company, on the type of…

A: Actually, program is a executable software that runs on a computer.

Q: Write a program that will calculate and print out bills for the city water company. The water rates…

A: The answer to the following question:-

Q: Write a program that calculates the potential energy of 3 charges q1 = 1, q2 = 2, q3 = 3 located at…

A: C program: #include <stdio.h>#include<math.h> // function to print distancefloat…

Q: Imagine that you run a local store that has an electronic pad located at the exit of the store that…

A: Below is a required program in python: Program Approach:   Display a message to the user to enter…

Q: Write a program that calculates the potential energy of 3 charges q1 = 1, q2 = 2, q3 = 3 located at…

A: For the given points (1, 2, 3), (3, -4, -5) and (-4, 2, -6) The rij is the distance between charges…

Q: Write a python program that asks the user to enter exam scores, the number is based on what the user…

A: def input_function(n, scores):    print("Enter the score(s):")    for i in range(n):…

Q: Write a program that lets the user enter the coordinates of the center and radius of two circles,…

A: Answer: C++ Source Code: #include <iostream>#include <cmath> using namespace std; int…

Q: Write a program in python that reports the contents of a compressed-gas cylinder based on the first…

A: color_code = input("Enter a character, representing the color of the cylinder: ")        # taking…

Q: Write a program ShippingCharges.cpp that asks for the weight of the package and the distance it is…

A: Use an if else structure to validate the values and then use if else if ladder to calculate amount

Q: Write a program for Horizon Phones, a provider of cellular phone service.Prompt a user for maximum…

A: code :-- //for Scanner classimport java.util.*; public class Main{ public static void main(String[]…

Q: Write a program with total change amount in pennies as an integer input, and output the change using…

A: A required Java program is as follows, File name: “LabProgram.java” import java.util.Scanner; public…

Q: Write a program that simulates car racing, as shown in Figure 9.29b–d. The car moves from left to…

A: Racing car: Write a program that simulates racing* The automobile moves from left to right. once it…

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: Purpose of the program: This program computes the taxable income and the federal tax amount for a…

Q: Write a program in Python that calculates the area of a circle. Begin by assigning 3.1416 to a…

A: Create a PYTHON program that imports the "math" module and "const" module that we have created in…

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: The question is to write a code for the given problem and no language has been mentioned, here C++…

Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…

A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…

Q: In Python, Write a program that continuously asks for a non-negative score until the user enters -1.…

A: def score(): total_score_entered = 0 Scores = [] possible_score_list = [] whileTrue: enter_score =…

Q: Write a program that shows the growth of money that occurs in a savings account. Your program should…

A: Program code: #prompt the user to enter initial balance initialBalance=int(input("Enter initial…

Q: Write a program with total change amount in pennies as an integer input, and output the change using…

A: Introduction of Program In this C++ program, the change will be calculated as given below 1 dollar =…

Q: Write a program that will calculate and print out bills for the city water company. The water rates…

A: Program code: #include <stdio.h> int main(){    char code;    float gallon, bill;…

Q: Imagine that you run a local store that has an electronic pad located at the exit of the store that…

A: Below is the required python program: - Approach: - Prompts the user to enter the positive clicks…

Q: In Python write a program that demonstrates the scenario below: An employee’s total weekly pay…

A: We need to provide a python program to employee’s total weekly pay. Where, total week pay= regular…

Q: Write a python program that computes the amount of calories burned when you run. Your program should…

A: Use an if-else ladder to find the MET with respect to speed

Q: Write a program that calculates and prints the bill for a cellular telephone company. The company…

A: code snippet:

Q: Write a python program that computes the zakat, obligatory charity, on camels. The program asks the…

A: Please give positive ratings for my efforts. Thanks.   PROGRAM   #function used def…

Q: Write a program that consists of the code below. a = 1 b = "One" c = 5.2 d = "5.2" e = "3" aa =…

A: Objective: According to the question, we need to rectify some errors and state the reasons for…

Q: write a program. There are three seating categories at a stadium. For a softball game, Class A…

A: #include <iostream>#include <iomanip>using namespace std; int main(){    int…

Q: Write a program that will calculate and print out bills for the city water company. The water rates…

A: Program code: #include <iostream>#include <cmath>using namespace std;int main(){int…

Q: in python: Write a program with total change amount as an integer input, and output the change…

A: In this question, first, we divide the input by 100 to make in dollars, and the remainder of the…

Q: Write a program that allows a player to play Rock, Paper, and Scissors against the computer. In this…

A: #include <iostream> using namespace std; // GetInput() - accepts the name and how many…

Q: create a Python program that simulates a race by calculating the distance Usain Bolt and a series of…

A: First of all, thanks for this fun question, the code is..... # Average speeds in miles per hour#…

Q: Write a program called p3.py that prints out a classic hangman stick figure. The program should ask…

A: We need to create the program according to the given output for the hangman in python.

Q: In Python: Write a program with total change amount as an integer input, and output the change…

A: Approach: Defining the main function  Getting the input from the  user that is the change  Checking…

Q: Write a program that gets a series of three letter acronyms (kısaltma), calculates the average word…

A:

Q: Write a program that calculates and prints the bill for a cellular telephone company. The company…

A: C++ Code: #include <iostream>#include <iomanip> using namespace std;int main(){    int…

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: PROGRAM: //header files #include <iostream> #include<iomanip>   //using namespace using…

Q: Write a python program that lets the user play the game of Rock, Paper, Scissors against the…

A: #Rock, Paper, Scissors Game import random while True: choice=int(input("Enter your choice 1.Rock,…

Q: Write in Python program... for an invoice calculation program, write the python program that…

A: code:

Q: Write a program that will calculate and print out bills for the city water company. The water rates…

A: The two inputs are char and float. Code is either H, C, or I. This is input to the switch statement.…

Q: Write a Python program that assigns the principal amount of R10000 to variable p, assign to n the…

A: P=1000n=12r=0.08t=int(input("Enter number of months interest will be compounded:…

Q: Write a program that allows you to play rock,paper, scissors against the computer. When first run…

A: #include <iostream>#include <stdio.h>#include <stdlib.h>#include <ctime>…

Q: In python, write a program that receives an integer, greater than or equal to 2, from the user and…

A: What is Python? Python is a widely used high-level, general-purpose programming language for…

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: Python Code Standard_Exemption = 4000; Tax_Salary = 0.0 tax = 0.0 child = 0 Marital_Status =…

Q: Write an application in Python that allows a user to play the game Bulls and Cows against a…

A: Lets see the solution.

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: Actually, c++ is a powerful general purpose language. The, code has been below:

Q: Write a program that can be used to calculate the federal tax. The tax is calculated as follows: For…

A: Purpose of the program: This program computes the taxable income and the federal tax amount for a…

Q: Write a python program for a pig game that has two players that alternate turns rolling dice. In…

A: