In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one: +5 reading frame +2 reading frame +1 reading frame +3 reading frame +4 reading frame

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: of hnRNA into mature mRNA incl

A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: A certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many…

A: Introduction  Short strands of amino acids connected by peptide bonds are called peptidides.…

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: The gene ABCD is 1500 bases long What would be the likely length of the pre-mRNA molecule? ____ What…

A: INTRODUCTION Exons are coding sections of an RNA transcript, or the DNA encoding it, that are…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: The process of addition of poly adenylate tail to a messenger RNA is known as Polyadenylation. The…

Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…

A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…

A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…

Q: As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and…

A: The pre-mRNA is formed from the DNA, which is further spliced to form mature mRNA. Splicing refers…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A:

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…

A: Through transcription the DNA molecule is converted into mRNA.

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Precursor messenger ribonucleic acid (pre-mRNA) is a type of primary transcript. It is transcribed…

Q: Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript…

A: The sequence of three RNA or DNA nucleotides that corresponds to a particular amino acid or stop…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…

A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: What polypeptide product would you expect from apoly-G mRNA that is 30 nucleotides long?

A: Introduction:- The mRNA is composed of nucleotides .A series of 3 bases is a codon.Each codon codes…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…

A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes  which consists of exons with all…

Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…

A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: What is the complementary DNA sequence to the following DNA sequence?   ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.

A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…