Q: Choose the combination of answers that most accurately completes the statement. Which of the…
A: Prokaryotes: - These are unicellular organism. Doesn't contain clearly defined nucleus or…
Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?
A: Transcription and translation are processes that a cell employs to create all of the proteins…
Q: 3' AAAACTGTGCAT5'
A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…
Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…
A: The central dogma of molecular biology describes the flow of genetic information in the cell from…
Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes
A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…
Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part…
Q: Compare the process of Replication, Transcription, and Translation by describing the following…
A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…
Q: Draw a nucleosome, indicating the positions of DNA andproteins.
A: All organisms have genomes that are very large in comparison to the size of their cells. The large…
Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…
A: DNA is made up of small units known as genes. These genes store all the hereditary information which…
Q: Refer to the double stranded DNA molecule with the sequence below to answer the following questions:…
A: The process of conversion of deoxyribonucleic acid (DNA) into ribonucleic acid (RNA) is called…
Q: de, translate the mRNA into an amino acid sequence.
A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…
Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…
A:
Q: List the 4 types of RNA degradation and describe each in 1 sentence
A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…
Q: Enumerate the types of RNA and identify the function of each type.
A: Ribonucleic acid (RNA) is a polymeric molecule that plays an important role in gene coding,…
Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…
A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…
Q: Describe how DNA is packaged using the words: DNA, Histone, Nucleosome, Condensed, and Chromosome
A: DNA is deoxyribonuclic acid, which is made up of two polynucleotide chain which coiled together to…
Q: Select the most complete list of correct structures involved in the process of transcription…
A: Transcription is a process involved in the expression of a gene that takes place in the nucleus of a…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: write the full form of RNA
A: Nucleic acids are large biomolecules or biopolymers. It is essential to all known forms of life. The…
Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…
A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…
Q: ion, mRNA codons, peptide bonds, nucleus.
A: The process of transcription to translation decides the fate of genetic material. Both of the…
Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…
A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…
Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…
A: This represents central dogma of molecular biology. It shows the flow of genetic information from…
Q: Compare and contrast: TRANSCRIPTION and TRANSLATION Give 2 similarities and 2 differences. Be…
A: Introduction DNA acts as a genetic material in our body. DNA contains gene or the basic unit of…
Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…
A: It is the process of the formation of proteins by the process of Translation. The proteins are…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition: CRISPR: A segment of DNA compiled of short repetitions of base…
Q: DNA RNA AMINO SENSE strand ANTISENSE CODON ANTICODON ACID strand ATG TAC САТ GTA АCA TGT TCG AGC
A: A trinucleotide sequence that is complementary to a matching codon in a messenger RNA (mRNA)…
Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…
A: Replication is the process of the formation of identical copies of DNA. It takes place in the…
Q: Use the following DNA sequence, and write the resulting messenger RNA sequence
A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…
Q: Diagram a section of DNA being transcribed. Give the various names for the two strands of DNA.
A: Transcription is the process of synthesizing of single-stranded mRNA strand from the double-helical…
Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?
A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: Write a paragraph about transcription, and include the following terms: transcription factors,…
A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…
Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: Describe where codons and anticodons are found.
A: INTRODUCTION Anticodons are sequences of nucleotides that are complementary to codons. they are…
Q: Define the following terms: a. DNA b. RNA c. genome d. transcription e. fructose
A: All are related to the molecular structure and are biomolecules
Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…
A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…
Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…
A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…
Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1
A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…
Q: Please write a paragraph and include an image about Translation and use the following terms (in the…
A: The deoxyribonucleic acid (DNA) is the genetic material in most organisms (a few viruses have RNA as…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code
A: Codon is a trinucleotide sequence of nucleic acids which corresponds to specific amino acids.…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Q: Define Overlapping code as they apply to the genetic code
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Indicate the differences between the coding and non-protein coding RNA.*
Write the answer.
Step by step
Solved in 2 steps
- Describe the translation and transcription using the figure.Write a paragraph about transcription, and include the following terms: transcription factors, promoter region, TATA box, RNA polymerase, elongation of RNA, and terminator sequence. DNA sense vs. nonsense strand and 5’ ends. And please include one image of what is happening.Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.
- Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU ala-met-stop ala-met-stop ala-met-phe phe-ala-metSelect the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA
- Select the most complete list of correct structures involved in the process of transcription a. mRNA, amino acids, ribosomes, polypeptide chains b. DNA, mRNA, RNA polymerase, a promoter c. mRNA, polypeptide chains, RNA polymerase d. DNA, mRNA, amino acidsDefine and identify the words listed below: CRISPR, codon, anti-codon, transcriptionExplain the process translation. A complete answer will include the words below tRNA, amino acid, polypeptide chain, ribosome, mRNA, codon, anticodon, nucleotides, base pairing rules, sequence