Answered: Introns in eukaryotic protein-coding…

Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about 65 bp. What is the reason for this minimum intron size?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Related questions

Q: For each of the following transcription factors, explain how eukaryotic transcriptional initiation…

A: A transcription factor is a sequence specific DNA-binding factor and upon binding to the DNA…

Q: What are the known exceptions to the genetic code?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: What is self-splicing intron? Cite two reasons that suggest cukaryotic spliceosomes originated from…

A: RNA (ribonucleic acid) is the complementary strand of DNA (deoxyribonucleic acid) which is…

Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: When an intron is undergoing the first step in splicing, where is the first breakage of the…

A: Gene splicing is a post translational process, which is a characteristic of eukaryotes and it…

Q: Introns in eukaryotic protein-coding genes are rarely shorter than 65 nucleotides in length. What…

A: In eukaryotes the template strand of DNA gets transcribed into pre-mRNA by the process known as…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Ans... a base substitution in an enhancer region

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: The process in which a specific sequence of DNA is copied to form a newly synthesized strand of…

Q: A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing…

A: according to the question, A gene contains eight sites where alternative splicing is possible:

Q: Why do Introns in a pre-operational transcript differ in size and number?

A: Introns An intron is any nucleotide sequence within a gene that is removed by RNA splicing to…

Q: One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why…

A: oligo(dT)are primer widely used for cDNA the synthesis generation of a high frequency of…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost…

A: Transcription is the first step in central dogma of protein synthesis. It involves formation of…

Q: What are the mechanistic similarities between group II intron self-splicing and spliceosomal…

A: The process of transcription involves the conversion of Deoxyribonucleic acid (DNA) into messenger…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: why is GTP hydrolysed in translation termination in bacteria? What are the by-products of…

A: The translation termination occurs when the stop codons are placed near the A site. These include…

Q: Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce…

A: Genetics is the branch of biology, which deals with the study of genes, their pattern of…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: Some eukaryotic mRNAs have an AU-rich element in the 3′ untranslated region. What would be the…

A: The 3’ UTR is the untranslated region in the mRNA that follows the termination codon of translation.…

Q: An insertion sequence contains a large deletion in its transposase gene. Under what circumstances…

A: The insertion sequence is the simple transposon of bacteria. Transposons are the DNA segments that…

Q: By comparing Figures 8-16 and 8-17 with Figure 8-18,speculate what features of RNA permit…

A: The features of RNA that permit self-splicing (that is, in the absence of proteins)is that RNA is…

Q: . Explain why a long open reading frame suggests theexistence of a protein-coding exon

A: Exons are the regions in DNA, which code for specific protein molecule. In order to identify exons…

Q: Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene. What will be the likely…

A: Alternative processing and splicing results in the production of multiple mRNA and proteins from…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What…

A: Unconstrained DNA sequence which are those sequences whose evolution is unaffected by selection are…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: How Can a Sequence Logo Be Used to Identify RibosomeBinding Sites on Bacterial mRNAs?

A: Introduction Bioinformatic is the advanced and recent branch of biology which utilizes computers…

Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…

Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…

A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…

Q: Explain why inserting 5 bp of DNA at the –50 position of a eukaryotic gene decreases the rate of RNA…

A: The process of transcription occurs in the nucleus, during which RNA molecule is synthesized from…

Q: Identify the DNA elements and protein factors, #1- 7, in the figure below that are involved in the…

A: Central Dogma = According to the central DNA is converted to RNA (transcription) and RNA to protein…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: There may be positive selection on introns if they are adapted to retaining specific stem-loop…

A: Introduction A nucleotide sequence within a gene which is excised out or removed during process…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: The coding sequence of the Gene F and G are given as 5'…

Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?

A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…

Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…

A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…

Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…

A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…

Q: Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other…

A: Transposing elements or the transposons are also known as the jumping genes. A transposable elements…

Q: For each of the following initiation factors, how would eukaryotic initiation of translation be…

A: The process of translation is characterized by the formation of the polypeptide or the proteins from…

Q: In eukaryotes, what types of modifications occur to pre-mRNAs?

A: Need to explain about the types of modifications occur to pre-mRNAs

Q: What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA…

A: The transcription of an mRNA encoding a 100-kDa protein by E. coli polymerase is known as…

Q: What is a frameshift error? Does the binding of methionine tRNA to the small subunit help reduce…

A: Answer: Introduction: Mutation- These are the random heritable changes that occurs in the DNA…

Q: Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter,…

A: The 5′ UTR is located in the first exon of the gene.

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about 65 bp. What is the reason for this minimum intron size?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Introns in protein-coding genes of some eukaryotes are rarely shorter than 65 nucleotides long. What might be a rationale for this limitation?
Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for removing them?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
What molecular biology strategy can best be used to determine Inhibition of the splicing of one intron from the parental RNA resulting in a longer protein product? Explain.
Considering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?
Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG. If the old protein sequence was Met-Thr-Arg-Leu-Leu, what will be the new sequence encoded by the mutant gene?
Why do you expect that intron removal wouldreduce the delay?
Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be non-overlapping?Experimentally, how were these suppositions shown to be correct?
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
Suppose that a 20-bp deletion occurs in the middle of exon 2 of the gene. What will be the likely effect of this deletion in the proteins produced by alternative splicing?