intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA moleciles Is made. 31. How does an RNA molecule get modified (what part is kept and what molecules are used, what gets added on)? before
Q: Cystic hibros Ife-threatering disease that causes thick, stcky mucus to buid up in areas of the…
A: DNA is the genetic material in living organisms that is transcribed into mRNA. This mRNA is used for…
Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…
A: 5' cap help in translation and prevent degradation of m- RNA and poly A tail help on initiation of…
Q: Maintenance methyltransferases recognize: CG sequences O CC sequences O CA sequences O CT sequences…
A: Question - Maintenance methyltransferases recognize: CG sequences CC sequences CA sequences CT…
Q: Vhich type of mutation occurs when a DNA sequence changes from GGA TCA CCG GAA... to GGA TCG CCG…
A: Step 1: A mutation is a change in our DNA sequence that occurs as a result of errors during DNA…
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: Initiation of transcription requires: O Okazaki fragments. Oa DNA primer. O an RNA primer. O DNA…
A: Need to find which is required for initiation of transcription from the following options.
Q: ou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?
A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…
Q: During retrotransposițion of a short interspersednuclear element (SINE), nicking the target site DNA…
A: A complete genetic material present in an organism is referred to as a genome. Deoxyribonucleic acid…
Q: Using the DNA template –TACTGGGTACAAGAACA- for transcription, what is the base sequence of the mRNA…
A: The genetic code is stored in the DNA, which is coded in the messenger RNAs (mRNAs) by a process…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…
A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…
Q: ⦁ Original: ATTTGAGCC Mutated: ATTGAGCC. This is an example of what kind of mutation?
A: The alteration, damage, or change in the gene of DNA occurs which can change the genetic information…
Q: STCATCTTGACATTG... 3' same strand now has a single base insertion of an A, indicated in blue. What…
A: A mutation is known as the changes or alteration brought in the DNA sequence which can change the…
Q: There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O…
A: Gene mutations involve alterations in the structure of gene which alters or modifies the structure…
Q: Huntington's disease in regards to Trinucleotide repeats give detailed reponses provide exmaples
A: Huntington's disease(HD) is caused due to mutation in the HD gene where the trinucleotide…
Q: The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs…
A: T7 RNA polymerase shares extensive sequence similarity with mitochondrial and chloroplast RNA…
Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…
A: Mutations are changes that occurs in nucleotide sequence of DNA.The types of mutation are:…
Q: Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA snRNA FRNA get of zibiotic ugs pped to pid Terioration…
A: Introduction :- RNA is a polymeric molecule . Role of RNA in different cellular processes ==…
Q: Transcript the template DNA (write in mRNA codons) *
A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…
Q: c. On the mature mRNA transcript in eukaryotes, start codon is not found at the beginning of the 5'…
A: Mature mRNA transcripts in eukaryotes are those eukaryotic RNA transcripts that have been spliced…
Q: RNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and…
A: The central dogma suggest that the DNA contain the requisite information to make the all our…
Q: arc associated With it's enpsio 2. what is an operon ? What re Tsiond,bet are Sionu not a partek the…
A: DNA (deoxyribonucleic acid) contains genetic information which is transcribed into amino acids or…
Q: D Question 9 Sequence of DNA that RNA polymerase binds to initiate transcription. O promoter O start…
A: RNA polymerase integrates RNA, utilizing the antisense strand of the DNA as format (Templat ) by…
Q: F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA…
A: Francis Crick proposed the central dogma which states that the DNA is replicated to produce DNA…
Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct…
A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…
Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…
A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…
Q: Examining Figure 20-8, explain why the rate of evolutionat nonsynonymous sites is lower. Do you…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can occur as a result…
Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…
A: Within the biological system, the flow of genetic information is explained as molecular biology's…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…
Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And…
A: mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: METHIONINE…
Q: 1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA…
A: Since you have asked multiple questions, we will answer first question for you. In order to get…
Q: 18. In order to m protein. You crea guide RNA comp sequence Gene that the CRISPR Gene Yis neces: a.…
A: CRISPR/ cas 9 Clustered regularly interspaced short palindromic repeats is a gene editing system…
Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will…
A: Mutations are changes that occur in the genetic sequence of an organism. These mutations have an…
Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…
A: DNA is two stranded ladder like structure which comprises of :- A) Coding strand B) Template…
Q: 8 QUESTION: Transcribe the gene. Write out the correct sequence of mRNA bases. Notice that this is…
A: Transcription is the synthesis of RNA from DNA segment with the help of RNA polymerase enzyme. It…
Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…
A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…
Q: TRNA is synthesized during transcription. OTrue O False Next Page Back
A: Tranfer RNA is a type of RNA molecule that help decode a messanger RNA and specifies an amino acid…
Q: GAC TATGCGGGA GGT GAAGCC ATGA would happen If fourrt A in the given sbrand mutated to t 2 And in…
A: Mutations are changes in the DNA sequence that occurs as a result of errors in the DNA copying…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…
A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…
Q: 25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Transcription is a process in which the genetic information in the DNA is converted into RNA in the…
Q: What does it define- defining theprocess of transcription- DNA to RNA The code is nonoverlapping
A: Nucleic acids are macromolecules composed of carbon, hydrogen, oxygen, nitrogen, and phosphorous.…
Q: TATAA AUG UAA Only known regulatory region TSS Mutation C. 3 nucleotides Mutation B: 20 nucleotides…
A: Mutations are the changes in the DNA sequence that may or may not have an effect on gene function…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: During protein synthesis, the nucleotide sequence of the mRNA is read in the form of triplets.
Q: The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode…
A: The C-terminal residue in a peptide is one that has a free carboxyl group or does not acylate…
Q: GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?
A: Adenine in RNA binds with uracil (Thymine is replaced by uracil in RNA) and guanine with cytosine.…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…
A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…
Q: sequences oT two con the following bacterlal promoter. The startpoint of transcription is shown in…
A: Transcription is the act of copying and interpreting information from a DNA strand into a new…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSExplain The mRNA codon of valine is: GUC UGG CCA TTG
- Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAWhat's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA
- Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
- 100All tRNA molecules have poly (A) tails at their 3' end. Yesornoa) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
