Question

keratinase is an enzyme produced by dermatophytes. which organs in the body would these pathogens fungi tend to proliferate in, and why?

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Other

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Portions of the __________ persist throughout life as the cores of the discs between vertebrae.

A: The vertebral column is the defining feature of vertebrates consisting of a series of about 33 bones...

Q: Can you please answer 16,17, and 18 please

A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...

Q: How does Genetic Drift and Non-random mating fit within the scope of Population Genetics?

A: Population genetics:Population genetics can be defined as the study of genetic variation in the popu...

Q: Microbiology-Discuss, in detail, all the genetic and cellular events encompassed in the clonal selec...

A: Lymphocytes (T and B cells) are the integral part of the cell-mediated immunity. They are responsibl...

Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the:   5’end; 3’ UTR; Polyadenyla...

A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is prese...

Q: Please Help me

A: All the individuals of a group that consists of common ancestors are considered as monophyletic grou...

Q: What is study of endocromology

A: Endocrinology is the branch of biology under which the endocrine system is studied. It includes the ...

Q: Which types of microtubules are essential for the major events occurring during anaphase B ? A. Inte...

A: During anaphase chromosome separate and move toward opposite poles. Anaphase divide into two phases:...

Q: What do GMO mean?

A: GMO means Genetically Modified OrganismsGMO is a new organism, not present in nature whose genetic m...

Q: Can you please do 26, and 27

A: Click to see the answer

Q: Which releases the greatest amount of energy? a. Anaerobic respiration b. Fermentation  c. Glycolysi...

A: Adenosine triphosphate (ATP) can store, release, and transport chemical energy within cells. The hyd...

Q: how is bicarbonate reabsorbed in the proximal tubule? explainthe role of Na+/H+ antiporter.

A: The proximal tubule:In kidneys, it is a segment of the nephron. It starts from the Bowman's capsule ...

Q: Tubulin is a protein with mass of approximately 55,000 Da. Approximately  how many amino acids must ...

A: The correct option is d.The molecular mass of an amino acid present in a protein molecule is 110 Dal...

Q: Now calculate the slope and equation for the best fit line. You may use excel

A: Click to see the answer

Q: Recombination of alleles in homologous chromosomes occurs during a. anaphase I b. meiosis I c. proph...

A: Eukaryotic cells are denoted either as haploid or diploid, which depends on the number of chromosome...

Q: How to carry one red blood from the stomach to the left eye?

A: The left eye of the body is supplied by the ophthalmic artery by means of several branches. It is or...

Q: What is the difference between male and female marchantia

A: Marchantia is a thalloid liverwort. It is usually seen as large colonies on damp surfaces. They are ...

Q: Viewing Object Through the Microscope: If the diameter of the low-power field is 1.5mm, an object th...

A: “Magnification” is the process of enlarging an object. The microscopic magnification is used to make...

Q: WHat is trypsin?

A: Trypsin is a serine protease responsible for the hydrolysis of proteins in the digestive tract. It i...

Q: Can you please label the skull

A: A skull is a bony structure that is composed of cranium and facial bones. The composition and the sh...

Q: The Gardasil 9 vaccine prevents infection by all types of human papillomaviruses. True or False

A: The given statement is false.Human papillomaviruses (HPV) cause sexually transmitted diseases that c...

Q: Please Help me

A: According to the biological species concept, a species is a member of a population that potentially ...

Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after perform...

A: Forward genetics screen is method used to identify the genes controlling a phenotype in the organism...

Q: One    metabolic    scenario that    leads to insulin    resistance is the elevation    of the concc...

A: Insulin resistance is defined as the inactivity of insulin in its target cells. The examples of targ...

Q: Draw and label a simplified model of an atom. Explain how this model misrepresents our understanding...

A: An atom is the smallest component of an element present everywhere in the universe. It is made up of...

Q: Please select all of the statements that apply to chlamydial infections.   (NOTE:  Please change all...

A: Chlamydia trachomatis:It is usually known as Chlamydia. It is gram-negative bacterium. It causes a s...

Q: i am studying for my first test and a question came up that i cant make sense of. the question is "w...

A: The IVDs are intervertebral discs present between adjacently located vertebrae in the spinal column....

Q: What is a simple way of making a knockout mouse in terms of DNA recombinant technology?

A: A knockout mouse, or knock-out mouse, is a genetically modified mouse in which researchers have inac...

Q: What are the pros and cons of tail docking in dogs? please list more than one and be specific

A: Tail docking refers to removal of the portion of a dog’s tail through surgical means. This is usuall...

Q: Differentiate between axial region and perpendicular region

A: Click to see the answer

Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A...

A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved qu...

Q: The acromial region is ________________ to the otic region. (medial or lateral)

A: The acromial region is the location where shoulder bones are present.Otic region present in skull ar...

Q: The origin of the gluteus maximus is the_______. Lateral condyle Medial condyle Head of ...

A: Click to see the answer

Q: Within a population of butterflies, the color brown (B) is dominant over the color white (b). And, 4...

A: According to the Hardy-Weinberg equilibrium, the frequencies of the alleles and genotypes in a popul...

Q: You have two beakers. One contains pure water, the other contains pure methanol (wood alcohol). The ...

A: Solubility is defined as the chemical property that indicates the ability of the substance, that is,...

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: You are a physician who has diagnosed a patient with a genetic condition that results in telomerase ...

A: Telomere is the sequence of repetitive nucleotides present at the ends of the chromosomes. Telomeres...

Q: List key characteristics of the normal microbiota of the digestive system.

A: Microbiota is related to microorganisms. They are generally found in multicellular organisms. Microb...

Q: Choose ONE of the following macromolecules: lipids (membrane), DNA (genes) or protein. Then, explain...

A: Free radicals are molecular species which contain an unpaired electron. Consequently, they are some ...

Q: Threats on biodiversity are synergistic. This means

A: Biodiversity means the variability among living organisms in the earth from all sources such as terr...

Q: Distinguish between each of the following pairs of terms: Neutron and proton Atomic number and mass...

A: Neutron – They are found in the nucleus of an atom.  They do not possess any charge on them they are...

Q: Describe the observations and inferences that led Charles Darwin to his theory of evolution by natur...

A: Charles Darwin gave the theory of evolution through natural selection. According to this theory, org...

Q: What is a codon? A gene? A chromosome?

A: Nucleic acids are essential for all known forms of life. It is of two types, namely, deoxyribonuclei...

Q: Explain the mechanism by which DNA is replicated.

A: DNA replication in prokaryotes is an essential mechanism to maintain the consistency of characters i...

Q: What are the two ways environmental signals promote a cellular response. what cellular process is ta...

A: The binding of chemical signals to their corresponding receptors induces events within the cell that...

Q: Why must starch be hydrolyzed before it can be used as an energy source or transported?

A: Carbohydrates are the sugars that include monosaccharides (simple sugars) and polysaccharides. Starc...

Q: Prevention of rabies in humans involves passive immunity and active immunity.   True or False

A: The given statement is true as rabies prevention in humans involves passive as well as active immuni...

Q: What would be an example of humoral stimuli on a hormonal level? Would transport functions that incl...

A: The three stimuli that control the endocrine glands for the synthesis and secretion of hormones are ...

Q: Describe three interesting ways relate chemistry to biochemistry and the human body.

A: Chemistry is the study of elements and compounds formed of atoms, molecules, and ions. It includes t...