Let's consider a protein with two surface-exposed histidine residues: • Hisa is a "typical" histidine residue with pK = 6.2 • Hisg is involved in a stabilizing interaction (His-NH* --- -0,C-Glu) with a neighboring glutamic acid residue. For Hisg, the Gibbs free energy of deprotonation at pH = 7.0 and T = 293 K is AG'º = +15 kJ mol-1. If you had a solution, at pH = 7.0 and T = 293 K, containing this protein: a) What fraction of Hisa residues are protonated? b) What fraction of Hisg residues are protonated? c) What is the pK, of Hisg?

Q: Based on the figure and the explanation in the textbook, what are the random chances that the…

A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124…

Q: Both hsp60-like and hsp70 molecular chaperonesshare an affinity for exposed hydrophobic patches on…

A: Molecular chaperones are defined as the proteins that aid or help in the folding or unfolding of…

Q: what would the net charge on the tetra peptide of sequence ala-lys-glu-ser at ph 7.2 what would it…

A: Amino acids are the building blocks of proteins or peptides formed of chiral carbon having four…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: Both hsp60-like and hsp 70 molecular chaperones share an affinity for exposed hydrophobic patches on…

A: Answer: Molecular chaperones are defined as the proteins that aid or help in the folding or…

Q: At physiological pH (i.e. 7.4), polylysine assumes a random structure in solution. Given that the…

A: Protein are complex structures made up of polypeptide chains comprising different amino acids.…

Q: Carboxypeptidase, which sequentially removes carboxyl-terminal amino acid residues from its peptide…

A: Enzymes are a group of proteins that acts as biological catalysts to accelerate the various chemical…

Q: Choose ALL of the charged (+1 or -1) amino acids at aqueous physiological conditions where the ph=…

A: Amino acid is the basic structural unit of proteins. They contain an amino group, a carboxyl group,…

Q: The major difference between a protein molecule in its native state and in its denatured state lies…

A: The Native state of a protein is the functional three-dimensional form of a protein. The Native…

Q: To better understand the effects of palmitoylation on protein X, researchers want to chemically…

A: Palmitoylation is an attachment which is covalent of Palmitic acid, which is a fatty acid to…

Q: Given a tripeptide Cys-His-Lys, Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82; Pk2 =…

A: pK refers to pH at which a particular group is exactly 50% ionized. A tripeptide is a peptide…

Q: Saccharide M, a sugar made of repeating units of maltose and cellobiose, is a component of…

A: Glycoproteins are consisted of protein and glycan moiety which is involved in several biological…

Q: In some proteins, the side chain of serine appears to undergo ionization. Explain why ionization…

A: Serine proteases like chymotrypsin are most studied biological enzyme and uses covalent modification…

Q: In the amino acid sequence below, the amino acid residue in red was shown to be essential to the…

A: Peptides or proteins are composed of twenty standard amino acids. These standard amino acids differ…

Q: The oligopeptide isolated from the brain of an animal has the sequence…

A: Introduction :- Proteins are made up amino acids ( linked with each other by the help of peptide…

Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…

A: Metalloprotein linkages are most likely to be formed between?

Q: What is the most consistently (i.e. found in every case) energetically unfavorable aspect of protein…

A: People have developed molecular dynamics simulations of the basic atomic forces that determine a…

Q: a. Suppose that the R group of a histidine residue in a protein in its native tertiary structure is…

A: In the protein, the nonpolar amino acids are usually present in the inner hydrophobic region. Also…

Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S1…

A: Serine proteases are proteolytic enzymes that cleave peptide bonds. They are hydrolases that use a…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11…

A: Hi! Thanks for your question. As you have posted multiple sub-parts, we are answering only the first…

Q: You are in the process of determining theamino acid sequence of a protein and must reconcile…

A: In the first trial, the protein has glycine at the amino terminal while asparagine at the carboxyl…

Q: (a) As the pH changes from 9.0 to 5.0, how does the concentration of H+ (protons) change?…

A: pH is a scale used to specify the acidity or basicity of an aqueous solution. Acidic solutions are…

Q: Eukaryotic protein X has one proline residue and two cysteine residues. The proline needs to be in…

A: Eukaryotic protein : It is usually the cytoplasmic ribosomes that translate nuclear genes. several…

Q: Consider a protein in which a negatively charged glutamic acid side chain (pKa = 4.2) makes a salt…

A: Amino acid is organic compound which contains a carboxyl group, an amino group, and a variable side…

Q: Imagine a globular protein with a histidine that is involved in a salt bridge to an aspartic acid,…

A: Globular proteins are a group of protein sub-types. They form colloids  and are somewhat soluble in…

Q: Experimental results describing a protein's amino acid composition are useful for estimating the…

A: Proteins are biological macromolecules composed of amino acids linked together by peptide bonds. The…

Q: Given a tripeptide Cys-His-Lys,   Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82; Pk2 =…

A: The pKa values of amino acid side chains that constitute a protein play an important role in…

Q: The amino acid that is often used as a tag (in a run of 6-8 of this amino acid in a row) for protein…

A: Living cells have a complex system for protein synthesis. Ribosomes synthesize amino acid chains.…

Q: When performing his experiments on protein refolding, Christian Anfinsen obtained a quite different…

A: Anfinsen showed that the protein folding data resides within the amino acid sequence of the protein.…

Q: Consider a hexapeptide of the sequence thr asn glu trp lys gln. After complete hydrolysis, which…

A: Asked : Amino acid which elutes first

Q: list the amino acids that will carry a net charge at pH 7 within a protein. What is the charge at pH…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: why do you think this is? In your explanation, you should describe the specific molecular…

A: 1. Proline is rarely found in beta sheets or alpha helices this is because proline is totally…

Q: A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new…

A: The new protein identified here has a partial sequence given as TVEVNAPGDVQKALSELQQINDGRLDIRI…

Q: What is the fraction of the peptide that has the N-terminal amino group deprotonated at pH 9.…

A: The above peptide sequence is made up of five amino acids. First is Lysine, second valine, third…

Q: Do you expect a Pro → Gly mutation in a surface-loop region of a globular protein to be stabilizing…

A: Mutation : It is an alteration in the nucleotide sequence of the genome of an organism, virus, or…

Q: Approximate molecular weight for an unknown protein from gel-filtration experiment is 130 kDa.…

A: Given Values: Molecular weight obtained from gel-filtration experiment = 130 kDa Weight of the…

Q: A mixture of proteins having molecular weights of 50 to 200 kDa can be  fractionated linearly using…

A: 50 kDa is less elucidate..

Q: . The process of a protein folding from an inactive unfolded structure to the active folded…

A: Amino acids interact with one another to give proteins. They require a well-defined 3D structure by…

Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…

A: Histidine is a basic residue having a amino group in its side chain and involved in the form of…

Q: Certain enzymes catalyze the covalent linkage of an acetyl group to lysine amino acids as shown…

A: Options 3 and 4 are correct. Acetylation changes tertiary structure of protein and partner protein…

Q: The amide hydrogen atoms of peptide bonds within proteins can exchange with protons in the solvent.…

A: Mass spectroscopy : It is an analytical technique that is used to measure the mass-to-change ratio…

Q: Consider the phenolic hydroxyl group of a particular Tyr residue in a protein. Suppose the hydroxyl…

A: The unfolded region protein is hydrophilic and protein resent in the folded region are called…

Q: a. Suppose that you have the peptide Ala-Gly-Tyr-His-Leu and you treat it with FDNB and then 6M HCl.…

A: FDNB (1-fluoro-2,4-dinitrobenzene) is called Sanger's reagent to detect the N-terminal amino acids…

Q: Predict the direction of migration for the following amino acids in solutions of the specified pH.…

A: Amino acids contain at least one alpha-amino group and one alpha-carboxylic group present in them.…

Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…

A: Polypeptide is formed when amino acids are joined together with peptide bonds. Peptide bond is…

Q: Hello, I am trying to understand how to calculate the overall charge of a peptide at pH = 7. Please…

A: Peptides are composed of twenty standard amino acids attached together via peptide bonds. These…

Q: Shown is the electrophoretic profile of a pure protein ran at different pH values "H H H H (+) (-)…

A: The net charge of a protein depends on the pH of its environment and the net charge determines the…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.