19. Match the letters with the enzymes and macromolecules involved in DNA replication:AEBDNA POLYMERASECATALYZES COMALENTLINKAGE OF NUCLEOSIDETRIPHOSPHATE INTOGROWING NEW STRANDINCOMINGNUCLEOSIDED'TRIPHOSPHATE PAIRSWITH A BASE IN THETEMPLATE STRANDA)i) pyrophosphate (Pi)ii) template strandii) incoming nucleoside triphosphateiv) new strandv) DNA polymerase

There are number of processes necessary for the continuation of generation , growth and…

Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING NUCLEOSIDE DNA POLYMERASE CATALYZES COVALENT D TRIPHOSPHATE PAIRS WITH A BASE IN THE LUNKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND TEMPLATE STRAND i) pyrophosphate (Pi) i) template strand i) incoming nucleoside triphosphate iv) new strand v) DNA polymerase

Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING NUCLEOSIDE DNA POLYMERASE CATALYZES COVALENT D TRIPHOSPHATE PAIRS WITH A BASE IN THE LUNKAGE OF NUCLEOSIDE TRIPHOSPHATE INTO GROWING NEW STRAND TEMPLATE STRAND i) pyrophosphate (Pi) i) template strand i) incoming nucleoside triphosphate iv) new strand v) DNA polymerase

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 17RQ: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
1) The function of ligase is to seal nicks in the backbone of a DNA strand. The function of AP endonuclease is to create a nick in the backbone of a DNA molecule adjacent to an apurinic site, which allows DNA polymerase II access to the DNA to repair the damage and prevent a mutation resulting from the use of a damaged or erroneous strand of DNA as template during DNA replication. Why doesn't ligase simply seal up the nicks the AP endonuclease introduces before DNA pol II can do anything?
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? a. C b. G c. A d. T 2. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? a. 5' TTACCGAAT 3' b. 3′ AATGGCTTA 5′ c. 5′ TAAGCCATT 3′ d. 3′ TTACCGAAT 5′ 3. This complex assembles and organizes nucleosomes and contributes to gene repression a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 4. Amino acids at the N-terminal end of eukaryotic polypeptides that contain the information required for the post-translational processing and…
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'