Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?

Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

What are the differences between translation and transcription in bacteria and eukaryotes? Give a brief description of how transcription works in bacteria using the words: initiation, elongation, and termination. Give a brief description of how mRNA is transcribed in the nucleus and leaves the nucleus. Must use words: 3’ cap, 5’ tail, ribsome, gene splicing, introns, nuclear pore.
Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated in places where the mRNA folds back on itself to form a hairpin-looped structure like the one shown below. How do you think that this structure stops transcription?
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
What is the production of RNA called and what is the enzyme that catalyzes the process?What are the similarities and differences between the transcription process and the repli-cation processes?Concerning their biological function what is the difference between DNA and RNA? Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?What is the difference between plasma membrane and cell wall?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthA in the template strand to a C? If so, what effect?
If the lacZ protein breaks down lactose, is it worthwhile to make it when there is no lactose around? How does the bacteria use this system to efficiently control the production of the lacZ protein? Does the presence of lactose in the cell alter its ability to repress translation? To what does the lacI protein bind to? What effect does the lacI gene have on transcription of the lacZ and lacY genes?
What are two advantages for circularizing the mRNA during the process of eukaryotic translation? (Select two correct answers) mRNA circularization ensures that translation terminates at the proper termination codons. mRNA circularization facilitates the binding of the ribosome to the Shine-Dalgarno sequence. mRNA circularization ensures that a full-length mRNA is used in the process of translation. mRNA circularization eliminates the requirement for translation factors in the process of translation initiation. mRNA circularization allows for a more efficient re-initiation of the translation process during repeated cycles of translation.
How is transcription different in eukaryotes compared to prokaryotes? Choose one: • Transcription occurs in the nucleus in eukaryotes and in the cytoplasm in prokaryotes. Eukaryotes transcribe both strands of DNA, while prokaryotes transcribe only one strand. Eukaryotes use RNA polymerase for transcription, while prokaryotes use ribosomes.
Which of the following processes is required for the initiation of transcription in bacteria? Select one: a. binding of sigma to the promoter region b. formation of a peptide bond in the elongating polypeptide chain c. formation of a phosphodiester bond in the elongating RNA strand d. binding of DNA polymerase to the promoter region
Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?
Select the events from eukaryotic transcription from the list below and list them below in order, by letter, from earliest to latest during transcription. A. Sigma factor binds 5'TTGACA?' B. Rho separates DNA/RNA hybrid C. TFIID binds TATA Box D. RNA Pol Il binds E. Holoenzyme forms F. Template strand is used to synthesize a 5' to 3' polymer G. Transcript is moved into the cytoplasm H. U1, U2, U4, U5 and U6 sn RNPs bind transcript