MICROGRAPH No. & Letter TYPICAL DRAWING Nucleus & chrön STRUCTURE 10 H Envelope & pores: Nucleus nuclear envelope chromatin nucleolus Nucleolus 10 C Nucleolus: pore Cytomembrane Rough ER: 1 A 6 E (blow-up) Rough ER Ribosome: Ribosome 6 Fblow-up) *Also locate ribosomes on rough ER in micro. 1 9 J Smooth ER: Smooth ER 7 B Golgi: Golgi complex (six are shown in photo) LY90SOME 4Y50SOME : Mitochondrion 4 B Mitochondrion:. 6 (blow-up) Chloroplast 9 C Chloroplast: Cytoskeletal Microfilaments 2 G Microfilaments: cross section (microfilaments inside a cut - lengthwise microvili) 2 H Microtubule 9 N 11 D cross section Microtubules: lengthwise Intermediate filaments (not visable in these no standard reprešentation Intermediate filaments: micrographs) CILIA FLAGELLA

MICROGRAPH No. & Letter TYPICAL DRAWING Nucleus & chrön STRUCTURE 10 H Envelope & pores: Nucleus nuclear envelope chromatin nucleolus Nucleolus 10 C Nucleolus: pore Cytomembrane Rough ER: 1 A 6 E (blow-up) Rough ER Ribosome: Ribosome 6 Fblow-up) *Also locate ribosomes on rough ER in micro. 1 9 J Smooth ER: Smooth ER 7 B Golgi: Golgi complex (six are shown in photo) LY90SOME 4Y50SOME : Mitochondrion 4 B Mitochondrion:. 6 (blow-up) Chloroplast 9 C Chloroplast: Cytoskeletal Microfilaments 2 G Microfilaments: cross section (microfilaments inside a cut - lengthwise microvili) 2 H Microtubule 9 N 11 D cross section Microtubules: lengthwise Intermediate filaments (not visable in these no standard reprešentation Intermediate filaments: micrographs) CILIA FLAGELLA

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 1CT: IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may...

See similar textbooks

Similar questions

Identical copies of chromatin held together by cohesin at the centromere are called.______ histones nucleosomes chromatin sister chromatids.
. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus
Complete the complementary strand: DNA replication ATTCGAGGCTAA
For each of the following pairs of chromatin types,which is the most condensed?a. 100 Å fiber or 300 Å fiberb. 300 Å fiber or DNA loops attached to a scaffoldc. euchromatin or heterochromatind. interphase chromosomes or metaphasechromosomes
Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
Which of the following structures could be found within the nucleolus? chromatin histones ribosomes nucleosomes
The spindle attaches to chromosomes at the _______. a. centriole b. contractile ring c. centromere d. centrosome
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
which letter dipicts leading strand A. J B. B C. K D. L
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
Arrange the levels of chromatin packing from most "open" to most condensed (chromosome, loops, nucleosomes, heterochromatin, 30-nm chromatin fiber)
Build a plypeptide DNA: TAC-TCC-CGG-GTT-ACC-ACT