Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT                      None                     100%                                      100%  1                          1-200                    130%                                       130% 2                       250-400                   100%                                       100% 3                       500-800                     50%                                         50% 4                      950-1100                      0%                                        100%   1) For the following gene, you notice the following results when analyzing several muntants. What type of sequence (be specific) has been mutated in mutant 1? What type of sequence (be specific) has been mutated in mutant 3? What would we call this type of mutation?  What type of sequence (be specific) has been mutated in mutant 4?

Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…

A:

Q: Tỏ idéntify transcriptional regulatory elements, reporters containing 100 base pairs of Promoter…

A: Reporter genes help us to understand and determine the expression of gene of interest by fusing them…

Q: The crystal structure has been determined for the complete 12-subunit yeast RNA polymerase II bound…

A: RNA polymerase II is an enzyme which is actively involved in the transcription process and the…

Q: . You are analyzing two different cells that transcribe the same gene called neurexin (NRXN). The…

A: Hi dear, here's your answer.

Q: True or False? LINE elements encode functional transposition protein and thus can move autonomously…

A: LINEs are widely distributed among eukaryotes. Approximately 21% of the genome is covered by LINEs…

Q: recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major…

A: Insulin is an important hormone, which is used for diabetes treatment as it help to reduce the blood…

Q: Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient…

A: Ans... a base substitution in an enhancer region

Q: 1. You are working with a known chemical that can cause a mutation in the DNA. You decide to use the…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots…

A: The genes are the sequence of nucleotides that are present on the chromosomes and encode for a…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: Conditional mutation is a type of unique mutations that depends on certain conditions and can lead…

Q: Explain what the term position effect means.

A: Position effect in genetics have different variations which result into new genotype and phenotypic…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: The process in which a specific sequence of DNA is copied to form a newly synthesized strand of…

Q: Select whether each of the components are associated with eukaryotic or prokaryotic transcription.…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: Bacteriophage lambda is as one of the routinely used molecular cloning vectors, which also served as…

A:

Q: For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?…

A: Transcription is the mechanism by which an RNA copy of a gene sequence is produced. This clone,…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: You are teaching a class on the regulation of eukaryotic gene expression. such as the promoter…

A: Binding of RNA polymerase II  and transcription factors is necessary for transcription.

Q: With several molecular biology techniques, researchers identified that the intertwined sequence…

A: Cell division is regulated by a network of genes and proteins through cell cycle checkpoints.…

Q: The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the…

A: Bioinformatics is the computational analysis, storage, and interpretation of biological data. It is…

Q: You made four mutants for a promoter sequence in DNA and studied them for transcription. The results…

A: Promoter are the sequence present in the DNA. These allow the binding of transcription factor and…

Q: A portion of the coding sequence of a cloned gene is shown…

A: The process of converting a DNA strand into mRNA is known as Transcription. The strand having the…

Q: To identify the following types of genetic occurrences, would acomputer program use sequence…

A: Introduction  With the advancements of Bioinformatics tools and sequencing techniques we can easily…

Q: The following figure shows a screen shot  from the UCSC Genome Browser, focusing  on a region of the…

A: MFAP3L MFAP3L gene is an abbreviated form of Mircrofibril associated Protein 3 Like gene . The gene…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: w is the diagram of a eukaryotic gene that encodes a protein. The promoter and n start sites are…

A: Post transcriptional modification removes introns and add existing exons together in the primary RNA…

Q: A bacterial species has a hypothetical sigma  promoter that has the following sequence: TTGGCA ­-…

A: The sequence of nucleotides required for the initiation of transcription is known as the sigma…

Q: Refer to figure, which shows the distribution of histone H2A.Z on nucleosomes near a transcription…

A: The DNA is compactly packed in the nucleus because of the presence of the histone proteins which are…

Q: Expression of recombinant proteins in yeast is an important tool for biotechnology companies that…

A: Recombinant proteins are those proteins that are produced by recombinant DNA cloned in a system…

Q: Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in progressive destruction of the…

A: Insertion or deletion mutation causes frame-shift mutation, it changes the amino-acid sequence of…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: Using the following expression vector and the insert of interest with flaking region (PCR product of…

A: Restriction enzymes are special enzymes that nicks DNA at specific positions. It is mainly used in…

Q: The following represents a transcription unit in a hypothetical DNA molecule in E.coli.…

A: DNA ( Deoxyribonucleic acid ) is a double stranded molecule whereas RNA is single stranded.…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: Introduction  Termination of transcription: It involves the termination of RNA chain synthesis by…

Q: . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from…

A: Mutation It can occur due to errors in DNA copying during cell division, ionising radiation…

Q: 13-2 For a and its regulatory sequences, the following mutation results have been found. gene…

A: Transcription is the first step in gene expression. During this process, the DNA sequence of a gene…

Q: Identify the best match between the mutation description and term.   a. Transversion: results in a…

A: Often mutation occurs in our body. These mutations can be beneficial or lethal. The mutation occurs…

Q: protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the…

A: CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily…

Q: Transcribe and Translate the following DNA. Be sure to label which sequence is your transcript and…

A: The Central Dogma is the process by which the DNA is ultimately produce a polypeptide chain or…

Q: Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for…

A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by errors…

Q: ATTTGAGCC- Original ATTGAGCC - Mutated   The example above is an example of a  Nonsense Deletion-…

A: Any detectable , inheritable qualitative or quantative change in genetic material of an organism not…

Q: Genome-wide RNAi screens target expression of > 16,000 genes. Explain how each of these 16,000+…

A: The control of gene expression in a cell to inhibit the expression of a specific gene is known as…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: The protein encoded is DNA ligase that helps in connecting two strands of DNA together by forming a…

Q: How do you think that transcription randomizes positions of nucleosomes and repression restores the…

A: As per the honor code, we only answer one question at a time therefore we are answering the first…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: The conditional mutation is a condition where the wild-type genotype is expressed under certain…

Q: A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive…

A: Conditional mutants have been using for various experimental studies. because, they can be grown…

Q: You are studying a gene containing three exons (exon 1 = 66 nucleotides , exon 2 = 99 nucleotides ,…

A: One strategy that can be used here is alternative splicing where different combinations of exons…

Q: You synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing…

A: Answer :- There is one option is correct

Q: Please indicate whether the following statement is true or false In eukaryotes, promoter escape…

A:

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.