Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9 (highlighted in red cytosine) on the gene's segment above. Now determine the resulting protein sequences of the new mutant gene's segment. e) Explain the effect of this mutation on the function of the protein. What is the type of this mutation? Relate to symptoms of CF disease (see the above symptoms). THE GENETIC CODE Second letter A UCU UAU ) Tyr UAC UGU Cys UU Phe UUC UCC UGC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUA UCA Leu UUG UCG CUU CCU CAU CGU CAC CAA His CUC CC CGC Leu Pro CCA CCG Arg CUA CGA CUG Gin CAG CGG ACU ACC AUU AAU AGU Ser AUC lle AAC Asn AGC Thr A AUA ACA AAA Lys AGG AGA AUG Met ACG AAG Arg GGU Asp GUU GCU GAU GUC Val GCC GAC GGC Ala Gly GAA Glu GUA GCA GGA GUG GCG GAG GGG Third letter DCAG POAG コ0てO First letter
Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9 (highlighted in red cytosine) on the gene's segment above. Now determine the resulting protein sequences of the new mutant gene's segment. e) Explain the effect of this mutation on the function of the protein. What is the type of this mutation? Relate to symptoms of CF disease (see the above symptoms). THE GENETIC CODE Second letter A UCU UAU ) Tyr UAC UGU Cys UU Phe UUC UCC UGC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUA UCA Leu UUG UCG CUU CCU CAU CGU CAC CAA His CUC CC CGC Leu Pro CCA CCG Arg CUA CGA CUG Gin CAG CGG ACU ACC AUU AAU AGU Ser AUC lle AAC Asn AGC Thr A AUA ACA AAA Lys AGG AGA AUG Met ACG AAG Arg GGU Asp GUU GCU GAU GUC Val GCC GAC GGC Ala Gly GAA Glu GUA GCA GGA GUG GCG GAG GGG Third letter DCAG POAG コ0てO First letter
Biology 2e
2nd Edition
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark
Chapter9: Cell Communication
Section: Chapter Questions
Problem 18RQ: How does PKC’s signaling role change in response to growth factor signaling versus an immune...
Related questions
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
Recommended textbooks for you
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Anatomy & Physiology
Biology
ISBN:
9781938168130
Author:
Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:
OpenStax College
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning