R-loop b RNA Coding region of DNA

Q: The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A:

Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to…

A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various coding…

Q: DNA ligase catalyzes the formation of a peptide bond without adding another nucleotide to the…

A: The DNA backbone is made up of deoxyribose sugar and phosphate groups. The phosphate group joins two…

Q: A mutation in which one nitrogenous base is substituted for another.. O never occurs in eggs or…

A: At a specific gene locus, a change in the typical DNA sequence. Although the term has a negative…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: missense mutation: D Adds a base OProduces a different amino acid O Deletes a base O Causes a…

A: The mutation is the change in the original nucleotide sequence of DNA resulting in the change in…

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'

A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…

Q: Below is a schematic of the molecule that inserts the fourth amino acid (a tryptophan) into the…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: TRNA O is a type of RNA molecule. required for accurate translation. O all of the choices are…

A: Translation is the process by which the RNA molecule is read and translated into proteins. The three…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: A mutation in which one nitrogenous base is substituted for another. O never occurs in eggs or sperm…

A: Mutations are new sudden inheritable discontinuous variations which appear in the organisms due to…

Q: Which of these outcomes is most likely to result in a leaky mutation?

A: Introduction Mutations causing partial inactivation rather than complete loss of function in the…

Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…

A: A genome is the genetic material of an organism. It consists of deoxyribonucleic acid (DNA). The…

Q: The codons CCU, CCC, CCA, and CCG all code for the amino acid threonine.  This is because the…

A: A codon is a three-letter code on mRNA. A codon codes for an amino acid.

Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…

A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: A)

Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…

A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…

Q: The triplet code allows many amino acids to be specified by more than one codon. Such a code is said…

A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino…

Q: How do I determine the eventual amino acid code from: 3' TACCCCGGGTTTCAACATG 5'  -(TEMPLATE STRAND)…

A: In double stranded DNA , one strand is known as template strand and other one is the coding strand.…

Q: What does it mean that the genetic code is redundant? It's very repetitive to have to study the…

A: Redundant means degenerate. Codon amino acid arrangement is such that only one amino acid is encoded…

Q: Single-base substitutions are not always a problem because they shift all subsequent codons…

A: Single base substitutions -a base replaced by another base.

Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices

A: The conversion of DNA's genetic information into mRNA takes place by a process known as…

Q: 37 Transposons in eukaryotes are mechanistically different from bacterial transposons. Yes or no…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…

A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: Some chemicals are known to cause mutations in DNA. EMS is a chemical that usually induces deletion…

A: Ethyl methanesulfonate is a mutagenic, teratogenic, and carcinogenic organic compound with formula…

Q: Acyclovir is best said to be a / an: Select one: O a. nucleoside Ob. nuclear base C. MRNA drug Od…

A: Acyclovir : Acyclovir is an antiviral medicine generally used for the treatment of viral diseases.…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: 3)Which of the following are involved in translation? Choose all that apply ribosome tRNA amino…

A: Answer-  Involved in translation are  :- ribosome tRNA  mRNA rRNA amino acids

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…

A: Transcription is the process by which the information of DNA are copied into mRNA and this process…

Q: Can you please answer number 28 and 29

A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a…

Q: In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A…

A: The information recorded inside the DNA sequence of one or more genes is transcribed into a strand…

Q: Which of the following statement(s) is/are true. You can select multiple options. Select all that…

A: Insertion or deletion of 3 or more nucleotides does not cause frame shift mutation. Frame shift…

Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…

A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…

Q: TRANSCRIPTION Transcription is the process in which the information from is converted into a…

A:

Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…

A: Transcription is the process where mRNA will from form DNA, then mRNA will from protein in…

Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…

A: Codons are the set of three nucleotides which encode a particular amino acid.

Q: Innoor an A |RROTEL HERE........god ba

A: In this question we have to describe about the process of translution.

Q: In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many…

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: As bacterial DNA replicates, a point mutation occurs in which an A nucleotide is changed to a C…

A: DNA is a helically twisted double chain polydeoxyribonucleotide macromolecule. The sequence of…

Q: Karenca was studying her genetics notes the night before the test. She was getting a little turned…

A: Mutation is sudden  change in the sequence of DNA during the time of cell division, environment…

Q: A certain section of the coding (sense) strand of some DNA looks like this: ATGCTAGAGTGA It's known…

A: Given: Coding strand: 5'-ATGCTAGAGTGA-3' So we have,  Template strand: 3'-TACGATCTCACT-5' The mRNA…

Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate

A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.