RNA polymerase (NMP), + n(PP;) n(NTP) As the equation reveals, nucleoside triphosphates (NTPS) serve as substrates for the enzyme, which catalyzes the polymerization of nucleoside monophosphates (NMPS), or nucleotides, into a polynucleotide chain (NMP)n. Nucleo- tides are linked during synthesis by 5' to 3' phosphodiester bonds (see Figure 10.12). The energy released by cleaving the triphosphate precursor into the monophosphate form drives the reaction, and inorganic diphosphates (PP;) are produced.

RNA polymerase (NMP), + n(PP;) n(NTP) As the equation reveals, nucleoside triphosphates (NTPS) serve as substrates for the enzyme, which catalyzes the polymerization of nucleoside monophosphates (NMPS), or nucleotides, into a polynucleotide chain (NMP)n. Nucleo- tides are linked during synthesis by 5' to 3' phosphodiester bonds (see Figure 10.12). The energy released by cleaving the triphosphate precursor into the monophosphate form drives the reaction, and inorganic diphosphates (PP;) are produced.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing unlabeled (notradioactive) GTP, CTP, and TTP plus adenine nucleoside triphosphate with all its phosphorus atoms in theform of the radioactive isotope 32P. Will both daughtermolecules be radioactive? Explain. Then repeat thequestion for the molecule5′-ATATATATATATAT-3′3′-TATATATATATATA-5′
Staphylococcus nuclease is an enzyme that catalyzes the hydrolysis of DNA.The reaction is catalyzed by Ca2+, Glu 43, and Arg 87. Explain how the metal catalyst facilitates this reaction. Recall that the nucleotides in DNA havephosphodiester linkages.
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Treating a solution of ribonuclease with 2-mercaptoethanol and urea denatures the enzyme. If the 2-mercaptoethanol is removed, followed by the removal of urea, the ability of the enzyme solution to hydrolyse RNA is reduced by about 99%. What is the most plausible explanation for this observation? a. All of the RNase molecules have about 1% of their usual activity, due to changes to the organisation of disulphide bonds b. Random formation of disulphide bonds mean about 1% of the RNase molecules are 100% active whereas 99% have no activity c. Deprotonation of histidine in the active site of the enzyme means that only about 1% of the enzyme molecules are active d. Deprotonation of histidine in the active site of the enzyme means that all of the enzyme molecules have 1% of their usual activity
Why is ti advantageous for a cell to expend metabolic energy to polymerize gulucose molecule.?
Using the pKa data in as shown and the Henderson-Hasselbalch equation,calculate the approximate net charge on each of the four common ribonucleoside 5′-monophosphates (rNMPs) at pH 3.8. If a mixture of these rNMPs was placed in an electrophoresis apparatus, as shown, draw four bands to predict the direction and relative migration rate of each.
Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.
Human insulin is prodụced as a recombinant protein in the yeast Saccharomyces cerevisiae The protein is extracted and purified for the treatment of diabetes -a $32 billion industry! For efficacy, insulin must be modified by the addition of oligosaccharyl (sugar) groups If you were a scientist working on this project, how would you isolate the glycosylated insulin from the un- glycosylated forms?
Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.
Comparing the Mechanisms of Action of EF-Tu/EF-Ts and DnaK/ GrpE (Integrates with Chapter 30.) In what ways are the mechanisms of action of EF-Tu/EF-Ts and Dna K/GrpE similar? What mechanist ic functions do the ribosome A-site and DnaJ have in common?