Sequence A AC GAATTC (EcoRI) NNNN... Sequence Probability Calculation Length 1 2 6 n 1/4 = (1/4)¹= 0.25 1/4*4 = (1/4)2 = 0.0625 1/4*14*14*14*14*1/4 = (1/4)6 = 2.44 x 10-4 14*14*14*... (1/4) Predicted Occurrence in a Sequence the Length of the Human Genome (3,234,830,000 bases) 808,707,500 202,176,875 89,753 (1/4)n* 3,234,830,000 Focus questions A. What is the probability that any base in a sequence is an adenine, A? How many times do you expect to find adenine in the human genome? P(A)= .25 808,707,500 times = expected occurrance of A B. What is the probability of finding a particular two-base sequence? How many times do you expect to find that sequence in the human genome? P(2-base seq) = . 0625 202, 176,875 times = expected occurrance of sequence C. How many times would you expect to find an EcoRI cut site in a fragment of DNA 1,000,000 base pairs long?

Sequence A AC GAATTC (EcoRI) NNNN... Sequence Probability Calculation Length 1 2 6 n 1/4 = (1/4)¹= 0.25 1/44 = (1/4)2 = 0.0625 1/4141414141/4 = (1/4)6 = 2.44 x 10-4 141414... (1/4) Predicted Occurrence in a Sequence the Length of the Human Genome (3,234,830,000 bases) 808,707,500 202,176,875 89,753 (1/4)n 3,234,830,000 Focus questions A. What is the probability that any base in a sequence is an adenine, A? How many times do you expect to find adenine in the human genome? P(A)= .25 808,707,500 times = expected occurrance of A B. What is the probability of finding a particular two-base sequence? How many times do you expect to find that sequence in the human genome? P(2-base seq) = . 0625 202, 176,875 times = expected occurrance of sequence C. How many times would you expect to find an EcoRI cut site in a fragment of DNA 1,000,000 base pairs long?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Hơ many mismatches would you expect to find between this sequence and the reference sequence? I know the answer is 3, can you please explain why?
For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
Assuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?
You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5’-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3’ 3’-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5’
What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide frequency from my sequence.
Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCG