Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′ end in the picture.(b) Identify the template strand. (c) The nontemplate strand is also called the “sense strand.” Explain.

Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′ end in the picture.(b) Identify the template strand. (c) The nontemplate strand is also called the “sense strand.” Explain.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Related questions

Q: Does replication occur in one direction or both directions along the parental (old) strand?

A: DNA replication is the biological process of producing identical replicas of DNA from the parental…

Q: Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: Why did Okazaki propose that lagging strand synthesis proceeds through the synthesis of short…

A: The effective copying of double-stranded chromosomal DNA is required for cellular DNA replication.…

Q: What is the complementary strand of TTGACAGTAAAA?

A: Deoxyribonucleic acid (DNA) consists of two polynucleotide chains which are held together by…

Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…

A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…

Q: Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?

A: DNA replication is the process by which a double stranded DNA (dsDNA) makes a copy of itself to…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors, The…

Q: Provide a chemical explanation of why DNA synthesis proceeds in a 5'- to-3' direction.

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: Why is DNA gyrase necessary for replication?

A: DNA gyrase is an enzyme of class topoisomerase and subclass of topoisomerase type II. DNA…

Q: Describe in detail the semi Conservative replication of the DNA double helix structure

A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…

Q: Hello, can you help and explain to me what the difference between agglutination and coagulation? And…

A: Dna replication is the process of converting two parents strands of the double helical dna into two…

Q: Explain how the structure of DNA enables the molecule to be easily transcribed. Why is this…

A: DNA has a primary structure of double stranded helix with the building blocks as nucleotides. The…

Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…

A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…

Q: In an RNA strand that is ready for translation, what is the base pair rule that would apply?

A: The translation is the process by which a protein is synthesized from the information contained in a…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?

A: Different macromolecules are present in the body, and they include carbohydrates, proteins, lipids,…

Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…

A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…

Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…

A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…

Q: (a) What will be the problem during DNA replication if the enzyme primase becomes non-functional?…

A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…

Q: a) Within Region 1, which strand will be the template for leading strand synthesis, the top or the…

A: Dna replication occur inside the nucleus and it require the enzyme and other replication factors and…

Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…

A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…

Q: Which statement is TRUE regarding the DNA ligase mechanism?

A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…

Q: Describe the movement of the open complex along the DNA.

A: The open complex is used in the process of transcription when the DNA template is used to produce…

Q: As the strands are synthesized in replication, which of the following is true?

A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…

Q: Explain, If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?

A: The DNA or deoxyribonucleic acid is the genetic material of all the living organisms and it is…

Q: If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would…

A: The change in the nucleotide sequence can occur due to the mutation in the gene expression. These…

Q: What features of the structure of DNA enable it to be replicated?

A: Biomolecules are organic compounds found in living organisms. Examples of biomolecules includes…

Q: Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the…

A: The bacterial chromosome is usually circular in shape: hence it can be completely replicated by the…

Q: Why do longer DNA molecules move more slowlythan shorter ones during electrophoresis?

A: The gel electrophoresis is a technique to separate DNA fragments based on their size, the gel…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Why is it necessary to unwind the DNA helix in the replication process?

A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…

Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…

A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…

Q: Is DNA fragmentation genetic?

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Explain, on the basis of nucleotide structure, why DNA synthesis proceeds in the 5’-to-3' direction.

A: The deoxyribonucleic acid (DNA) is known as a double helix structure in which two strands are joined…

Q: How often, on average, would you expect a restriction endonuclease to cut a DNA molecule if the…

A: Restriction endonucleases are enzymes that function like molecular scissors. They cut the…

Q: Can you recall the two chemical differences between DNA and RNA?

A: The material used to store genetic information in the mitochondria or nuclei of an organism’s cells…

Q: From an extract of human cell growing in tissue culture, A fibrous substance was obtained. How would…

A: Introduction: The primary structure of both DNA and RNA are similar. Each consists of a…

Q: Name 3 structural features of the DNA and how they help the DNA perform its functions

A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine. These four…

Question

Shown is a representation of a DNA molecule being transcribed.
(a) Identify every 3′ end and every 5′ end in the picture.
(b) Identify the template strand. (c) The nontemplate strand is also called the “sense strand.” Explain.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Concept introduction

VIEW

Step 2 Explanation

VIEW

Step 3 Conclusion

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the helix? If the original strand serves as the template for transcription, what is the sequence on the new formed RNA strand?
Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.
If the DNA template strand was TACCTAGAT, what would the mRNA codons be?
If the genetic code used 4 bases at a time, how many amino acids could be encoded?
From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
Describe the movement of the open complex along the DNA.
Why do higher salt concentrations stabilize the DNA double helix? Or What aspect of the structure of double-stranded DNA destabilizes the helix in the absence of salt?
What amino acid is coded by the original sequence (GTA) if the sequence refers to the template strand?
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?