Some studies have shown that cholesterol plays an important role in the entry of SARS-CoV-2 into human cells. Please develop a hypothesis explaining this observation. Be as specific as possible in your explanation of your hypothesis.

Some studies have shown that cholesterol plays an important role in the entry of SARS-CoV-2 into human cells. Please develop a hypothesis explaining this observation. Be as specific as possible in your explanation of your hypothesis.

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter17: The Immune System And Disease

Section: Chapter Questions

Problem 18CTQ: Different MHC class I molecules between donor and recipient cells can lead to rejection of a...

See similar textbooks

Related questions

Q: Why do traits with a higher heritability tend to evolve faster? Unlike monogenic traits,…

A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…

Q: Oxygen-binding proteins myoglobin and hemoglobin require the prosthetic group ______.

A: Myoglobin and hemoglobin are protein molecules found in muscles and blood respectively. Myoglobin…

Q: In experiments using polymerase chain reactions (PCR), it is often more difficult to amplify through…

A: Introduction :- Polymerase Chain Reaction (PCR) is a laboratory technique used to make many copies…

Q: I need articles about the topic of people die because a enlargement of the heart

A: Introduction: The heart is a vital organ in the human body, responsible for pumping blood and…

Q: What can you personally contribute to safeguard the environment and care for non-human animals?

A: We can contribute to safeguarding the environment by reducing my energy consumption, recycling and…

Q: 7. In the binomial naming system, scientific names are written in italics, with the first word…

A: Introduction : A species is classified and named using the binominal nomenclature system, which…

Q: Mendelian genetics

A: Biological inheritance: The process of passing of characters from parent to the offspring (i.e.,…

Q: 16. Which of the following statements about fetal breathing is TRUE? It_ O is only exhibited by some…

A: Zygote is produced by the fusion of male gamete (sperm) and female gamete (egg). This process is…

Q: Which two processes result in the introduction of genetic variation during meiosis? Provide a brief…

A: Introduction:- Genetic variation is defined as the variation or differences in the genetic material…

Q: Transcribing and translating transcribe and translate the following DNA molecules…

A: DNA (Deoxyribonucleic acid) acts as the hereditary or genetic material of almost all biological…

Q: What is the main question they addressed in "MicroRNAs Control De Novo DNA Methylation Through…

A: INTRODUCTION Mouse Embryonic Stem Cells (mESCs) are cells that are derived from the inner cell mass…

Q: Phylum Porifera: • Construct a Table with five rows and four columns. Column 1 will be labeled…

A: Porifera is a phylum of aquatic animals that include sponges. They are known for their porous and…

Q: In the binomial naming system, scientific names are written in italics, with the first word…

A: Organisms are classified so that they can be grouped and their characteristics could be studied…

Q: 3. Jeg 10 Place the following terms in their correct locations on Figure 1.6. anterior (cranial)…

A: Introduction - The plane is the surface on which the movement occurs or takes place.The axis is the…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: What biomolecule are promoters and enhancers composed of?

A: Biomolecules are organic compounds present inside the cells of the living organism. Protein, lipids,…

Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…

A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…

Q: Choose one biomechanical principle that you will need to keep in mind while performing each exercise…

A: Motion, force, momentum, levers, and balance are the five main elements in biomechanics: Motion is…

Q: Discuss the sympathetic and parasympathetic divisions of the autonomic nervous system. Why are these…

A: AUTONOMIC NERVOUS SYSTEM It is a part of peripheral nervous system which supplies internal organs,…

Q: How are sugars transported in phloem? the formation of starch from sugar in the sink increases the…

A: Sugars are essential for many biological processes and can be transported from source to sink in…

Q: What are the receptors involved in long term alcohol use binding and between GABBA agonist receptor…

A: We need to describe the receptors involved in long-term alcohol use interaction, as well as the…

Q: natural selection that leads to evolution of phenotypic differences A. Stabilizing selection…

A: Natural selection is the process by which species change over time as a result of environmental…

Q: why riboflavin absorbs in the UV-Vis region

A: Riboflavin, also referred to as Vitamin B2, is a water-soluble vitamin that is crucial for the…

Q: Which of the following organisms is most likely to have the highest total annual energy expenditure?…

A: Energy expenditure usually refers to the total amount of energy expended during biological processes…

Q: 1. Fill in the table below to indicate what happened to the elodea cells in each of the following…

A: Introduction:- Plant cells are eukaryotic cells that consists of well defined nucleus along with…

Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…

A: The goal here is to evaluate the relevance of animal anatomy and physiology and how it connects to…

Q: Which of the following represents the correct order of the phases of the cell cycle

A: Introduction: The cell cycle is the sequence of events that a cell goes through as it grows and…

Q: What type of chlorophyll used by cyanobacteria when shaded Chlorophyll a Chlorophyll b…

A: Cyanobacteria form the most important oxygen producing bacteria of the plane and are prokaryotes.…

Q: Label the dna

A: Introduction: DNA (Deoxyribonucleic Acid) is a long polymer that stores and transmits genetic…

Q: can you show how do you do the corss to see the result?

A: This is an example of epistasis where the effect of one gene masks the effect of other gene present…

Q: Is the whole protein (destined for the ER) synthesized and then moved to the ER or is it synthesized…

A: Introduction:- Protein molecules are the polymers of amino acids. Amino acids are linked with each…

Q: In 1975, the population of Peary caribou among the Arctic islands was around 28 000. In 1976, there…

A: To calculate the population change as a percentage, we need to find the difference between the…

Q: and decomposition According to the te at sequester carbor include carbon di

A: Introduction: The carbon cycle is a critical aspect of Earth's ecosystem, as it regulates the amount…

Q: Which of these statements describes an accurate model for how carbon dioxide and oxygen levels…

A: The ocean plays an important role in the global carbon cycle, exchanging carbon dioxide between the…

Q: A cell undergoing division has a haploid chromosome number of 15. Give the numerical value for each…

A: Since you have asked multiple sub parts, we will solve first three sub parts for you. If you want…

Q: What is the relationship between the structures (tissues and cells) and their location with respect…

A: In plants different types of tissues are found at different locations. These plants perform…

Q: Enzyme ptyalin pepsin trypsin small intestine Location mouth stomach Temperature (°C) 36.7-37.0…

A: The digestion is a process of breaking down the complex food components into the smaller components.…

Q: Ovulated oocyte Oocyte Ovarian ligament Ruptured follicle Primary follicles Primordial follicles…

A: The ovary is a female reproductive system primary gonad. It generates female reproductive cells…

Q: Assuming (i) that the two chromosomes in every homologous pair carry different alleles of some…

A: Introduction :- A chromosome is a structure in cells that contains genetic material in the form of…

Q: draw a punnett square, both parents are mixed hybrids, name the 4 possible offspring and the…

A: The above question asks for the construction of a Punnett square, which is a graphical…

Q: Which statement about pits is FALSE? O a. Aspiration of a pit pair is irreversible. O b. The margo…

A: introduction In plant pits means the thinner portions of the cell wall and through pit cells can…

Q: Which of these endocrine cells are also target cells for other hormones? (choose the most inclusive…

A: Introduction : The endocrine glands in the body produce hormones, which are unique chemical…

Q: माइटोसिस के इस चरण में # गुणसूत्रों और # समरूप जोड़े का संकेत दें, चाहे वे दोहराए गए हों या नहीं, और…

A: Introduction- Mitosis:Definition: The sequence of processes by which a cell divides to form two…

Q: Using the figure below for the areas labeled "1" give the name of the axis Yaw and what it controls…

A: The motion of fish has six degrees of freedom because the movement along each of the three axes is…

Q: Describe the levels of organisation within the human body

A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…

Q: Fill in the blank The ______ acts to position RNA polymerase II for transcription initiation. The…

A: Introduction :- Histones are proteins that play a crucial role in packaging and organizing the DNA…

Q: A- B C D E- Prokaryotic Cell Structure -F 4041 -G -H Match the prokaryotic cell structure to the…

Q: Phenotype Genotype Dominant Recessive Diploid III III |||| E A trait that can be expressed from only…

A: Introducion Genetics is a branch of science that deals with the study of genes, genetic variation…

Q: In a 10-month-old child, excessive excitability, sleep disturbances, reduced muscle tone, delayed…

A: The condition of excessive excitability, sleep disturbances, reduced muscle tone and delayed…

Q: MUSCLES (a) relaxed sacromere (b) contracted sacromere What is a sarcomere? Maria Wiek: weinely B…

A: INTRODUCTION Muscles are bundles of specialized cells in the body that contract to produce movement.…

Concept explainers

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given your current understanding of what we have learned about the SARS-CoV-2 virus and the disease it causes, CoVID-19, which of the following recommended practices make sense, based on the scientific knowledge you now have? Explain your answer for each: Remaining 6 feet away from other people, wearing non-medical masks, screening people for fevers before they can board planes or enter schools, not gathering in large groups.
To what cell-surface receptor does the SARS-CoV-2 Spike protein bind? a. What type of genome does SARS-CoV-2 have? Please help explain in less than 5 sentences! Thank you
If antibody responses are not elicited by a Covid-19 vaccine, are there other types of immune response that could provide protection from the SARS-Co-V2 virus following vaccination? Explain why or why not.
In our current situation of being in a global pandemic due to SARS-COV-2, otherwise known as COVID-19, you have heard news and updates here in the philippines and abroad. As a dental student - clinician, what do you think is the implication of this situation in our daily lives? What actions do you make in order to prevent yourselves from being infected?
Sequentially describe the five goals (attachment, entry, replication, assembly and release) of SARS-COV 2 during infection of a living cells.
Give a short review or commentary about "The origins and potential future of SARS-CoV-2 variants of concern in the evolving COVID-19 pandemic"
please explain SARS-CoV-2 spreads through cell-to-cell transmission
Shortly after the recovery from COVID 19, the plasma of the convalescent has significant quantities of anti - SARS CoV - 2 antibodies. This plasma was suggested to be used as therapy for other COVID - 19 patients by transfusing the plasma from the recovered individuals (donor) to the other COVID 19 patients (recipient). Do you think the identification of the ABO group of the donor and recipient is important and why?
Name 3 methods can be used to study the interaction between SARS-CoV-2 and ACE2?
A recent study showed that CYKNK-001 infusions saved a SARS-COV-2 patient. Based on your knowledge of how NK cells work, hand-draw a neat labelled diagram of a SARS-COV-2 infected cell and describe how an NK cell might recognize and destroy it.
This year, SARS-COV-2 strains have been reported to have mutated in the body of an immunocompromised individual. All mutations were seen in the spike protein. Using your knowledge of antigens and antibodies, describe the implications of a mutation at the spike protein.
question 1: what are 2 good potential targets in SARS-CoV2 virus to stop it from functioning ? (HINT: Think antibodies targeting important viral proteins) question 2: what is the Pfizer Vaccine composed of ? what does it target in SARS-CoV2 virus ? Can you connect it to any concept from Ch 17 in your course ?