T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2 binds to the 3' splice site. Eukaryotic ribosomes act to remodel chromatin or stabilize binding of the RNA polymerase. DNA sequences that prevent enhancers from acting on promoters located in adjacent domains are called boundaries.

T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2 binds to the 3' splice site. Eukaryotic ribosomes act to remodel chromatin or stabilize binding of the RNA polymerase. DNA sequences that prevent enhancers from acting on promoters located in adjacent domains are called boundaries.

Name: Are these true or false answers correct? If so, what is the proper wor
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Are these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false. T FT FTTFFThe major bonds in cellulose are a(1-4) bonds. Answer:During mRNA splicing, U2 binds to the 3' splice site.Eukaryotic ri

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at the bottom”) of a segment of double helical DNA contains the sequence (5′) TCCGCTCCATCG (3′). What is the base sequence of the mRNA that can be transcribed from this strand?
Label each true or false A.STTGATA3 is the consensus sequence of the -35 regulatory region of prokaryotic genes B. The chromosomes in the image to the right illustrate a reciprocal translocation: (picture) C. When histones are deacetylated, nucleosomes transcription is repressed.
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Which ribosomal subunit has the catalytic function for polypeptide biosynthesis? O a) the mRNA Ob) the nucleolus O c) there is no catalyst activity associated with peptide biosynthesis O d) 50s e) 30S
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
What would be the direct consequence to a cell of loss-of-function of Elongation Factor-Tu (EF-Tu)? You may select multiple answers. a. tRNAs would fail to exit the E site after giving up their amino acid. b. The error rate of translation would increase. c. The ribosome would frequently fail to identify the correct start codon and initiation of translation would become less efficient. d. There would be no pause between the entry of a tRNA into the A site and peptidyl transfer.
All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and RNA. B. Ribosomes coordinate with initiation and elongation factors to regulate translation. C. Ribosomes bind transcripts in their promoters. D. Prokaryotic ribosomes are comprised of a large and a small subunit. E. Ribosomes in eukaryotic cells bind to complete transcripts.
Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Ser
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
N-linked glycoproteins are glycosylated co-translationally at which consensussequence? A) Asn-X-Ser B) Met -Gly -X-Asn -X-Ser C) no specific sequence D) Ser- Asn -Thr E) Cys- X-As
Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose one or more: A. release of EF–Tu B. formation of a peptide bond C. formation of the 80S ribosome D. release of the new polypeptide chain E. translocation of the ribosome along the mRNA Reposting!!! Please do not post irrevelant answer
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.