The complement to a coding strand has the sequence 5' - TACTTTAGGATC - 3'. What is the MRNA strand for this sequence?

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: 3' AAAACTGTGCAT5'

A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence…

A: Step 1 Base pairing is formed in DNA (Deoxyribonucleic acid) double helix between purine of one…

Q: Provide the complementary strand and the RNA transcription product for the following DNA template…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA  is converted into a…

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: Given a sequence of a DNA coding strand:     5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: Based on one strand of a certain segment of DNA with the sequence below, answer the following…

A: DNA and RNA are major bio molecules found in the body. They help in transferring the information…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: A segment of a protein-encoding gene sequence is given below. 5'-AAGTTTGGCACT-3' 3'-TTCAAACCGTGA-5'…

A: Translation or protein synthesis is a process in which the genetic information present in m-RNA in…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY…

A: DNA to RNA is transcription and RNA to protein is a translation

Q: Which is the DNA template given if the MRNA O 3- GCCTACGGGCATATGGTA -5 JACGUA -3

A: During transcription mRNA is generated from DNA by the process called transcription .and then this…

Q: They add RNase-OUT to protect the RNA from which specific RNase? What does the inactivation of that…

A: Molecular biology is the branch of science which deals with the study of structure and functions of…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…

A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA  mRNA - Complementary to…

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’   a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3' 3'…

A: Phosphodiester linkages connect DNA strands, which are polymers or chains of deoxynucleoside…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: 2. DNA → AGA ACA TAA ATG CTC TTA ACA CTC ATC AGA CCA GCA CTC CGA TGA MRNA > tRNA → protein >

A: During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…

A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…

Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…

A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…

A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…

Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT

A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY…

A: DNA is transcribed into mRNA, mRNA then translated into proteins or peptides. In translation,…

Q: The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at…

A: Introduction: DNA is the genetic material that transfers from one to another except for some viruses…

Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…

A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…

Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this,…

A: INTRODUCTION The RNA polymerase enzyme will read the DNA strand and make the mRNA molecule.

Q: Coding strand CGT CTC TTC GGA CAC whar is the mRna strand

A: The process of formation of mRNA sequence  from the template strand of DNA is known as…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.